Incidental Mutation 'R7947:Nipsnap1'
ID649420
Institutional Source Beutler Lab
Gene Symbol Nipsnap1
Ensembl Gene ENSMUSG00000034285
Gene Namenipsnap homolog 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R7947 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location4873951-4894200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4889145 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 163 (R163G)
Ref Sequence ENSEMBL: ENSMUSP00000049338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038570] [ENSMUST00000136552] [ENSMUST00000139737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038570
AA Change: R163G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049338
Gene: ENSMUSG00000034285
AA Change: R163G

DomainStartEndE-ValueType
Pfam:NIPSNAP 185 282 2.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136552
Predicted Effect probably benign
Transcript: ENSMUST00000139737
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. A similar protein in mice inhibits the calcium channel TRPV6, and is also localized to the inner mitochondrial membrane where it may play a role in mitochondrial DNA maintenance. A pseudogene of this gene is located on the short arm of chromosome 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele treated with nocistatin fail to exhibit suppression of neuropeptide nociceptin/orphanin FQ-induced tactile allodynia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A G 16: 88,759,050 T51A probably benign Het
Abcc8 A G 7: 46,105,462 probably null Het
Accs A T 2: 93,844,257 M123K probably damaging Het
Ace G A 11: 105,973,054 G443S possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Arhgap25 T C 6: 87,463,087 D526G probably benign Het
Arhgef18 T C 8: 3,432,775 L160P probably damaging Het
Arnt T G 3: 95,474,526 probably null Het
Arntl T C 7: 113,287,146 Y137H probably damaging Het
Art3 A G 5: 92,392,500 N34S possibly damaging Het
Avl9 A T 6: 56,723,541 E53D possibly damaging Het
AW209491 A T 13: 14,636,862 E100V probably benign Het
Axin2 T C 11: 108,923,703 I139T probably damaging Het
Birc7 G T 2: 180,933,310 V280L probably damaging Het
C1ra A G 6: 124,517,379 N262D probably benign Het
Cacna1g A G 11: 94,457,175 F696L probably benign Het
Casp14 T A 10: 78,714,245 probably null Het
Crlf1 T C 8: 70,499,212 Y176H probably damaging Het
Dnajb4 A T 3: 152,186,831 S122T probably benign Het
Dthd1 G A 5: 62,814,310 D159N possibly damaging Het
Erich6 A T 3: 58,621,278 I517N possibly damaging Het
Fam118b T A 9: 35,217,943 H343L probably benign Het
Fam35a C T 14: 34,268,479 V157I probably benign Het
Fam96a A G 9: 66,138,402 I151V probably benign Het
Fat2 T A 11: 55,287,734 D1500V probably damaging Het
Fcgbp T C 7: 28,104,170 probably null Het
Fgfrl1 A G 5: 108,705,276 D255G probably damaging Het
Gm9611 G A 14: 42,296,130 Q82* probably null Het
Ifit3 G T 19: 34,587,959 E302* probably null Het
Igkv3-9 G A 6: 70,588,753 C112Y probably damaging Het
Ints4 A G 7: 97,499,585 T233A probably benign Het
Khnyn A T 14: 55,887,602 S438C probably damaging Het
Kifc1 T C 17: 33,883,875 R192G probably benign Het
Kntc1 T C 5: 123,781,888 S98P unknown Het
Krt2 A T 15: 101,816,334 D280E probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Macf1 T C 4: 123,401,407 I5344V probably damaging Het
Mcf2l A T 8: 13,003,529 probably null Het
Mms22l A C 4: 24,505,373 H211P probably damaging Het
Nusap1 A G 2: 119,647,135 N375S possibly damaging Het
Olfr146 A G 9: 39,019,451 L30P probably damaging Het
Olfr574 A G 7: 102,949,071 Y202C probably damaging Het
Olfr603 A T 7: 103,383,528 V158D possibly damaging Het
Phf14 G A 6: 11,933,307 G56D unknown Het
Phykpl G A 11: 51,586,581 V67M probably damaging Het
Pigk A G 3: 152,747,767 D374G probably benign Het
Pirb A G 7: 3,719,858 V45A probably damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Rb1cc1 T C 1: 6,248,562 V735A probably damaging Het
Rcor2 A G 19: 7,273,860 T333A possibly damaging Het
Ret A G 6: 118,174,344 V593A probably benign Het
Scgb1b10 A T 7: 32,101,145 D53V probably damaging Het
Sec61a2 G A 2: 5,876,983 A212V probably damaging Het
Sgpl1 A T 10: 61,106,342 F245I probably damaging Het
Sh2d4b A C 14: 40,820,766 V351G probably damaging Het
Slc22a1 T A 17: 12,652,423 M484L probably benign Het
Slit1 C G 19: 41,610,808 G1066R probably damaging Het
Slit1 A T 19: 41,610,809 D1065E probably benign Het
Spg11 G A 2: 122,092,322 A882V probably damaging Het
Stab2 A C 10: 86,846,033 F2501L probably benign Het
Stim2 A T 5: 54,118,329 K607N probably damaging Het
Syde1 C T 10: 78,590,082 V84M probably damaging Het
Tepsin A T 11: 120,094,235 N202K probably benign Het
Tmem207 T A 16: 26,516,745 I81F possibly damaging Het
Tnc C A 4: 64,017,343 G452V probably damaging Het
Tshz1 G T 18: 84,015,657 Q209K probably damaging Het
Ttn A T 2: 76,943,352 N2308K unknown Het
Zfp266 A G 9: 20,499,252 I543T probably benign Het
Zfp777 G T 6: 48,024,711 P815Q probably damaging Het
Zhx3 A G 2: 160,781,095 I384T probably damaging Het
Other mutations in Nipsnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Nipsnap1 APN 11 4889098 missense possibly damaging 0.77
IGL01552:Nipsnap1 APN 11 4889124 missense probably damaging 1.00
IGL01744:Nipsnap1 APN 11 4889912 missense probably damaging 1.00
IGL01938:Nipsnap1 APN 11 4893134 missense probably benign 0.00
IGL03328:Nipsnap1 APN 11 4884096 missense possibly damaging 0.89
R0355:Nipsnap1 UTSW 11 4889957 missense probably damaging 1.00
R1126:Nipsnap1 UTSW 11 4884081 missense probably benign 0.01
R1815:Nipsnap1 UTSW 11 4889101 missense probably damaging 1.00
R2129:Nipsnap1 UTSW 11 4888932 missense probably benign 0.04
R2205:Nipsnap1 UTSW 11 4889974 missense possibly damaging 0.95
R4852:Nipsnap1 UTSW 11 4891468 nonsense probably null
R5776:Nipsnap1 UTSW 11 4888919 missense probably benign 0.00
R6073:Nipsnap1 UTSW 11 4888895 missense possibly damaging 0.86
R7122:Nipsnap1 UTSW 11 4883366 critical splice acceptor site probably null
R7263:Nipsnap1 UTSW 11 4882960 unclassified probably benign
R7538:Nipsnap1 UTSW 11 4884089 missense probably damaging 1.00
R8166:Nipsnap1 UTSW 11 4884057 missense probably benign 0.00
X0011:Nipsnap1 UTSW 11 4874069 missense probably benign
Z1177:Nipsnap1 UTSW 11 4889956 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGGTATCCCAGCATCCTG -3'
(R):5'- CTGAAGAAGCATCAGGCCAC -3'

Sequencing Primer
(F):5'- CCAGCATCCTGTGTGCATG -3'
(R):5'- CCTACCCTGAGCTCTTGCAAAG -3'
Posted On2020-09-15