Incidental Mutation 'R7947:Gm9611'
ID649431
Institutional Source Beutler Lab
Gene Symbol Gm9611
Ensembl Gene ENSMUSG00000095371
Gene Namepredicted gene 9611
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7947 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location42291907-42297358 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 42296130 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 82 (Q82*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100698]
Predicted Effect probably benign
Transcript: ENSMUST00000100698
SMART Domains Protein: ENSMUSP00000098263
Gene: ENSMUSG00000095371

DomainStartEndE-ValueType
Pfam:Takusan 1 32 8.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169972
AA Change: Q82*
SMART Domains Protein: ENSMUSP00000129118
Gene: ENSMUSG00000095371
AA Change: Q82*

DomainStartEndE-ValueType
Pfam:Takusan 57 137 2.9e-26 PFAM
coiled coil region 164 186 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A G 16: 88,759,050 T51A probably benign Het
Abcc8 A G 7: 46,105,462 probably null Het
Accs A T 2: 93,844,257 M123K probably damaging Het
Ace G A 11: 105,973,054 G443S possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Arhgap25 T C 6: 87,463,087 D526G probably benign Het
Arhgef18 T C 8: 3,432,775 L160P probably damaging Het
Arnt T G 3: 95,474,526 probably null Het
Arntl T C 7: 113,287,146 Y137H probably damaging Het
Art3 A G 5: 92,392,500 N34S possibly damaging Het
Avl9 A T 6: 56,723,541 E53D possibly damaging Het
AW209491 A T 13: 14,636,862 E100V probably benign Het
Axin2 T C 11: 108,923,703 I139T probably damaging Het
Birc7 G T 2: 180,933,310 V280L probably damaging Het
C1ra A G 6: 124,517,379 N262D probably benign Het
Cacna1g A G 11: 94,457,175 F696L probably benign Het
Casp14 T A 10: 78,714,245 probably null Het
Crlf1 T C 8: 70,499,212 Y176H probably damaging Het
Dnajb4 A T 3: 152,186,831 S122T probably benign Het
Dthd1 G A 5: 62,814,310 D159N possibly damaging Het
Erich6 A T 3: 58,621,278 I517N possibly damaging Het
Fam118b T A 9: 35,217,943 H343L probably benign Het
Fam35a C T 14: 34,268,479 V157I probably benign Het
Fam96a A G 9: 66,138,402 I151V probably benign Het
Fat2 T A 11: 55,287,734 D1500V probably damaging Het
Fcgbp T C 7: 28,104,170 probably null Het
Fgfrl1 A G 5: 108,705,276 D255G probably damaging Het
Ifit3 G T 19: 34,587,959 E302* probably null Het
Igkv3-9 G A 6: 70,588,753 C112Y probably damaging Het
Ints4 A G 7: 97,499,585 T233A probably benign Het
Khnyn A T 14: 55,887,602 S438C probably damaging Het
Kifc1 T C 17: 33,883,875 R192G probably benign Het
Kntc1 T C 5: 123,781,888 S98P unknown Het
Krt2 A T 15: 101,816,334 D280E probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Macf1 T C 4: 123,401,407 I5344V probably damaging Het
Mcf2l A T 8: 13,003,529 probably null Het
Mms22l A C 4: 24,505,373 H211P probably damaging Het
Nipsnap1 A G 11: 4,889,145 R163G possibly damaging Het
Nusap1 A G 2: 119,647,135 N375S possibly damaging Het
Olfr146 A G 9: 39,019,451 L30P probably damaging Het
Olfr574 A G 7: 102,949,071 Y202C probably damaging Het
Olfr603 A T 7: 103,383,528 V158D possibly damaging Het
Phf14 G A 6: 11,933,307 G56D unknown Het
Phykpl G A 11: 51,586,581 V67M probably damaging Het
Pigk A G 3: 152,747,767 D374G probably benign Het
Pirb A G 7: 3,719,858 V45A probably damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Rb1cc1 T C 1: 6,248,562 V735A probably damaging Het
Rcor2 A G 19: 7,273,860 T333A possibly damaging Het
Ret A G 6: 118,174,344 V593A probably benign Het
Scgb1b10 A T 7: 32,101,145 D53V probably damaging Het
Sec61a2 G A 2: 5,876,983 A212V probably damaging Het
Sgpl1 A T 10: 61,106,342 F245I probably damaging Het
Sh2d4b A C 14: 40,820,766 V351G probably damaging Het
Slc22a1 T A 17: 12,652,423 M484L probably benign Het
Slit1 C G 19: 41,610,808 G1066R probably damaging Het
Slit1 A T 19: 41,610,809 D1065E probably benign Het
Spg11 G A 2: 122,092,322 A882V probably damaging Het
Stab2 A C 10: 86,846,033 F2501L probably benign Het
Stim2 A T 5: 54,118,329 K607N probably damaging Het
Syde1 C T 10: 78,590,082 V84M probably damaging Het
Tepsin A T 11: 120,094,235 N202K probably benign Het
Tmem207 T A 16: 26,516,745 I81F possibly damaging Het
Tnc C A 4: 64,017,343 G452V probably damaging Het
Tshz1 G T 18: 84,015,657 Q209K probably damaging Het
Ttn A T 2: 76,943,352 N2308K unknown Het
Zfp266 A G 9: 20,499,252 I543T probably benign Het
Zfp777 G T 6: 48,024,711 P815Q probably damaging Het
Zhx3 A G 2: 160,781,095 I384T probably damaging Het
Other mutations in Gm9611
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Gm9611 APN 14 42294665 missense possibly damaging 0.92
PIT4431001:Gm9611 UTSW 14 42293931 missense
R2107:Gm9611 UTSW 14 42294654 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGGGTATGTAAACAGCCTGGAG -3'
(R):5'- TGATGCACTATCAGGGATTCTCAG -3'

Sequencing Primer
(F):5'- TATGTAAACAGCCTGGAGTTGTAGCC -3'
(R):5'- CTATCAGGGATTCTCAGTGTCTCTAG -3'
Posted On2020-09-15