Incidental Mutation 'R7949:Ddx18'
ID649444
Institutional Source Beutler Lab
Gene Symbol Ddx18
Ensembl Gene ENSMUSG00000001674
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R7949 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location121553835-121567989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121555318 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 580 (Y580H)
Ref Sequence ENSEMBL: ENSMUSP00000001724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001724]
Predicted Effect probably damaging
Transcript: ENSMUST00000001724
AA Change: Y580H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001724
Gene: ENSMUSG00000001674
AA Change: Y580H

DomainStartEndE-ValueType
coiled coil region 2 32 N/A INTRINSIC
internal_repeat_1 36 75 1.67e-5 PROSPERO
internal_repeat_1 66 105 1.67e-5 PROSPERO
low complexity region 109 117 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
DEXDc 188 393 1.95e-56 SMART
low complexity region 401 417 N/A INTRINSIC
HELICc 429 510 2.84e-26 SMART
DUF4217 550 613 1.65e-26 SMART
low complexity region 620 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134417
SMART Domains Protein: ENSMUSP00000114149
Gene: ENSMUSG00000001674

DomainStartEndE-ValueType
Blast:DEXDc 2 47 2e-22 BLAST
HELICc 65 146 2.84e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it is activated by Myc protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,293,595 probably null Het
Adgrv1 G A 13: 81,155,234 T6111M probably damaging Het
Adprhl1 T G 8: 13,224,225 R844S possibly damaging Het
Aldh1b1 A G 4: 45,802,807 E115G possibly damaging Het
Anp32a A G 9: 62,373,666 E170G unknown Het
Arhgap27 A G 11: 103,337,769 S349P probably damaging Het
Asns T A 6: 7,685,328 I110F probably damaging Het
Atad3a T C 4: 155,748,695 H437R possibly damaging Het
Atl2 C A 17: 79,859,860 R244L probably damaging Het
Bcl2l14 A T 6: 134,430,120 D222V probably damaging Het
Ccdc102a G T 8: 94,905,285 Q498K probably damaging Het
Cdc14b T C 13: 64,190,398 probably null Het
Cep162 T A 9: 87,206,848 M994L probably benign Het
Entpd6 C A 2: 150,770,277 probably null Het
Fer T A 17: 64,133,508 S707T probably damaging Het
Gabra6 A G 11: 42,316,999 V215A probably benign Het
Gm20671 A G 5: 32,819,944 V142A probably benign Het
Gm6614 C A 6: 141,994,265 G171C probably damaging Het
Gtf3c1 G T 7: 125,651,081 N1439K probably benign Het
Igbp1b T C 6: 138,658,416 K10R probably benign Het
Ighv5-8 TATATATATATATATATATATATA TATATATATATATATATATATATATA 12: 113,654,943 probably null Het
Igkv12-44 A T 6: 69,814,890 S30T probably benign Het
Immt A T 6: 71,874,343 R563* probably null Het
Jakmip1 A T 5: 37,182,148 Q1231L probably damaging Het
Jsrp1 T C 10: 80,812,072 T51A probably benign Het
Krtap31-1 A G 11: 99,908,318 T116A possibly damaging Het
Lrp8 T A 4: 107,803,327 D61E probably damaging Het
Mark2 T C 19: 7,284,716 D311G probably benign Het
Men1 C T 19: 6,338,293 S314L possibly damaging Het
Nxpe2 T C 9: 48,323,097 N290S possibly damaging Het
Olfr1458 T A 19: 13,103,246 probably null Het
Olfr452 T C 6: 42,790,654 V205A possibly damaging Het
Pcolce2 A T 9: 95,694,635 T320S probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phf21b G T 15: 84,791,835 P337H probably damaging Het
Pinlyp G T 7: 24,545,950 T15K probably damaging Het
Ppox A T 1: 171,277,948 S307R probably benign Het
Ptk7 T A 17: 46,586,461 E315V possibly damaging Het
Pxk T C 14: 8,144,233 I327T probably damaging Het
Rabgap1 A T 2: 37,563,479 K973I probably benign Het
Rbbp8 A T 18: 11,718,835 I238L probably benign Het
Runx2 T A 17: 44,735,555 D109V possibly damaging Het
Serpinb6a G A 13: 33,923,020 S183L probably benign Het
Sptlc3 T C 2: 139,625,875 I451T possibly damaging Het
Sugp1 A T 8: 70,056,503 Y142F possibly damaging Het
Sumf2 T C 5: 129,852,918 F98S probably damaging Het
Tmem120a C T 5: 135,742,366 E39K possibly damaging Het
Tnxb C T 17: 34,717,129 P2680L probably damaging Het
Zfp78 C G 7: 6,379,366 R472G possibly damaging Het
Other mutations in Ddx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Ddx18 APN 1 121564586 missense probably benign 0.00
IGL01999:Ddx18 APN 1 121561728 missense probably benign 0.19
IGL03056:Ddx18 APN 1 121564535 missense probably benign 0.00
IGL03388:Ddx18 APN 1 121565923 missense possibly damaging 0.86
R0550:Ddx18 UTSW 1 121555375 missense probably benign 0.40
R1883:Ddx18 UTSW 1 121567916 start gained probably benign
R1940:Ddx18 UTSW 1 121555224 missense probably damaging 1.00
R2169:Ddx18 UTSW 1 121558409 critical splice donor site probably null
R3113:Ddx18 UTSW 1 121566148 missense possibly damaging 0.65
R3414:Ddx18 UTSW 1 121562149 missense probably benign
R3763:Ddx18 UTSW 1 121561377 missense probably damaging 0.99
R4011:Ddx18 UTSW 1 121562081 missense probably benign 0.01
R4293:Ddx18 UTSW 1 121561392 missense probably benign 0.10
R4333:Ddx18 UTSW 1 121564602 missense probably benign 0.01
R4964:Ddx18 UTSW 1 121566094 missense probably benign 0.00
R5160:Ddx18 UTSW 1 121565879 critical splice donor site probably null
R5187:Ddx18 UTSW 1 121562128 missense probably damaging 0.98
R5259:Ddx18 UTSW 1 121567789 critical splice donor site probably null
R5656:Ddx18 UTSW 1 121561358 missense probably damaging 1.00
R8291:Ddx18 UTSW 1 121560175 missense probably damaging 0.99
R8318:Ddx18 UTSW 1 121566087 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCCAACTTACTGCAGAGCC -3'
(R):5'- ATGCTGGCTTGGACTCTGAG -3'

Sequencing Primer
(F):5'- TTACTGCAGAGCCCCAGCAG -3'
(R):5'- AACCTCAGTCTGGCACCTGTG -3'
Posted On2020-09-15