Incidental Mutation 'R7949:Sptlc3'
ID 649447
Institutional Source Beutler Lab
Gene Symbol Sptlc3
Ensembl Gene ENSMUSG00000039092
Gene Name serine palmitoyltransferase, long chain base subunit 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R7949 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 139493913-139637674 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139625875 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 451 (I451T)
Ref Sequence ENSEMBL: ENSMUSP00000048313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]
AlphaFold Q8BG54
Predicted Effect possibly damaging
Transcript: ENSMUST00000047370
AA Change: I451T

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: I451T

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110083
AA Change: I451T

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: I451T

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,293,595 probably null Het
Adgrv1 G A 13: 81,155,234 T6111M probably damaging Het
Adprhl1 T G 8: 13,224,225 R844S possibly damaging Het
Aldh1b1 A G 4: 45,802,807 E115G possibly damaging Het
Anp32a A G 9: 62,373,666 E170G unknown Het
Arhgap27 A G 11: 103,337,769 S349P probably damaging Het
Asns T A 6: 7,685,328 I110F probably damaging Het
Atad3a T C 4: 155,748,695 H437R possibly damaging Het
Atl2 C A 17: 79,859,860 R244L probably damaging Het
Bcl2l14 A T 6: 134,430,120 D222V probably damaging Het
Ccdc102a G T 8: 94,905,285 Q498K probably damaging Het
Cdc14b T C 13: 64,190,398 probably null Het
Cep162 T A 9: 87,206,848 M994L probably benign Het
Ddx18 A G 1: 121,555,318 Y580H probably damaging Het
Entpd6 C A 2: 150,770,277 probably null Het
Fer T A 17: 64,133,508 S707T probably damaging Het
Gabra6 A G 11: 42,316,999 V215A probably benign Het
Gm20671 A G 5: 32,819,944 V142A probably benign Het
Gm6614 C A 6: 141,994,265 G171C probably damaging Het
Gtf3c1 G T 7: 125,651,081 N1439K probably benign Het
Igbp1b T C 6: 138,658,416 K10R probably benign Het
Ighv5-8 TATATATATATATATATATATATA TATATATATATATATATATATATATA 12: 113,654,943 probably null Het
Igkv12-44 A T 6: 69,814,890 S30T probably benign Het
Immt A T 6: 71,874,343 R563* probably null Het
Jakmip1 A T 5: 37,182,148 Q1231L probably damaging Het
Jsrp1 T C 10: 80,812,072 T51A probably benign Het
Krtap31-1 A G 11: 99,908,318 T116A possibly damaging Het
Lrp8 T A 4: 107,803,327 D61E probably damaging Het
Mark2 T C 19: 7,284,716 D311G probably benign Het
Men1 C T 19: 6,338,293 S314L possibly damaging Het
Nxpe2 T C 9: 48,323,097 N290S possibly damaging Het
Olfr1458 T A 19: 13,103,246 probably null Het
Olfr452 T C 6: 42,790,654 V205A possibly damaging Het
Pcolce2 A T 9: 95,694,635 T320S probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phf21b G T 15: 84,791,835 P337H probably damaging Het
Pinlyp G T 7: 24,545,950 T15K probably damaging Het
Ppox A T 1: 171,277,948 S307R probably benign Het
Ptk7 T A 17: 46,586,461 E315V possibly damaging Het
Pxk T C 14: 8,144,233 I327T probably damaging Het
Rabgap1 A T 2: 37,563,479 K973I probably benign Het
Rbbp8 A T 18: 11,718,835 I238L probably benign Het
Runx2 T A 17: 44,735,555 D109V possibly damaging Het
Serpinb6a G A 13: 33,923,020 S183L probably benign Het
Sugp1 A T 8: 70,056,503 Y142F possibly damaging Het
Sumf2 T C 5: 129,852,918 F98S probably damaging Het
Tmem120a C T 5: 135,742,366 E39K possibly damaging Het
Tnxb C T 17: 34,717,129 P2680L probably damaging Het
Zfp78 C G 7: 6,379,366 R472G possibly damaging Het
Other mutations in Sptlc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Sptlc3 APN 2 139546421 missense possibly damaging 0.55
IGL01537:Sptlc3 APN 2 139589695 missense possibly damaging 0.95
IGL01996:Sptlc3 APN 2 139581504 splice site probably benign
IGL02512:Sptlc3 APN 2 139547203 missense probably damaging 1.00
IGL03278:Sptlc3 APN 2 139589659 missense probably damaging 1.00
IGL03286:Sptlc3 APN 2 139589659 missense probably damaging 1.00
R0266:Sptlc3 UTSW 2 139596037 missense possibly damaging 0.93
R0362:Sptlc3 UTSW 2 139546555 splice site probably benign
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1494:Sptlc3 UTSW 2 139589560 missense possibly damaging 0.58
R1847:Sptlc3 UTSW 2 139625923 missense probably benign 0.08
R1919:Sptlc3 UTSW 2 139566675 missense possibly damaging 0.66
R2093:Sptlc3 UTSW 2 139625874 missense possibly damaging 0.89
R2396:Sptlc3 UTSW 2 139566586 missense probably benign 0.44
R2972:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R2973:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R2974:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R4601:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4602:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4610:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4745:Sptlc3 UTSW 2 139547167 missense probably damaging 1.00
R4779:Sptlc3 UTSW 2 139589589 missense probably benign 0.04
R4992:Sptlc3 UTSW 2 139596003 missense probably benign 0.04
R5162:Sptlc3 UTSW 2 139631343 missense probably benign 0.11
R5401:Sptlc3 UTSW 2 139636723 missense possibly damaging 0.75
R5406:Sptlc3 UTSW 2 139546478 missense probably benign 0.26
R5642:Sptlc3 UTSW 2 139546408 missense probably damaging 0.96
R5840:Sptlc3 UTSW 2 139547206 missense probably damaging 1.00
R6057:Sptlc3 UTSW 2 139581613 missense probably damaging 0.99
R6376:Sptlc3 UTSW 2 139636772 missense probably benign 0.21
R6852:Sptlc3 UTSW 2 139566586 missense probably benign 0.44
R7026:Sptlc3 UTSW 2 139537688 missense probably benign
R7412:Sptlc3 UTSW 2 139589617 missense possibly damaging 0.75
R7516:Sptlc3 UTSW 2 139589518 missense probably benign 0.11
R7733:Sptlc3 UTSW 2 139631368 missense possibly damaging 0.77
R7826:Sptlc3 UTSW 2 139547195 missense probably benign 0.44
R9224:Sptlc3 UTSW 2 139494234 missense probably benign 0.17
R9237:Sptlc3 UTSW 2 139566685 missense probably benign 0.40
R9319:Sptlc3 UTSW 2 139636810 missense possibly damaging 0.65
R9330:Sptlc3 UTSW 2 139546503 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTCTCCTAGGCACAACACAG -3'
(R):5'- AAGCACACAATCTAGTTCATGC -3'

Sequencing Primer
(F):5'- ACAGTACTTGTGTCTGATCACC -3'
(R):5'- TCTAGTTCATGCAAAGGAAAACCTC -3'
Posted On 2020-09-15