Incidental Mutation 'R7949:Cep162'
ID649471
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7949 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87206848 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 994 (M994L)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably benign
Transcript: ENSMUST00000093802
AA Change: M994L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: M994L

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,293,595 probably null Het
Adgrv1 G A 13: 81,155,234 T6111M probably damaging Het
Adprhl1 T G 8: 13,224,225 R844S possibly damaging Het
Aldh1b1 A G 4: 45,802,807 E115G possibly damaging Het
Anp32a A G 9: 62,373,666 E170G unknown Het
Arhgap27 A G 11: 103,337,769 S349P probably damaging Het
Asns T A 6: 7,685,328 I110F probably damaging Het
Atad3a T C 4: 155,748,695 H437R possibly damaging Het
Atl2 C A 17: 79,859,860 R244L probably damaging Het
Bcl2l14 A T 6: 134,430,120 D222V probably damaging Het
Ccdc102a G T 8: 94,905,285 Q498K probably damaging Het
Cdc14b T C 13: 64,190,398 probably null Het
Ddx18 A G 1: 121,555,318 Y580H probably damaging Het
Entpd6 C A 2: 150,770,277 probably null Het
Fer T A 17: 64,133,508 S707T probably damaging Het
Gabra6 A G 11: 42,316,999 V215A probably benign Het
Gm20671 A G 5: 32,819,944 V142A probably benign Het
Gm6614 C A 6: 141,994,265 G171C probably damaging Het
Gtf3c1 G T 7: 125,651,081 N1439K probably benign Het
Igbp1b T C 6: 138,658,416 K10R probably benign Het
Ighv5-8 TATATATATATATATATATATATA TATATATATATATATATATATATATA 12: 113,654,943 probably null Het
Igkv12-44 A T 6: 69,814,890 S30T probably benign Het
Immt A T 6: 71,874,343 R563* probably null Het
Jakmip1 A T 5: 37,182,148 Q1231L probably damaging Het
Jsrp1 T C 10: 80,812,072 T51A probably benign Het
Krtap31-1 A G 11: 99,908,318 T116A possibly damaging Het
Lrp8 T A 4: 107,803,327 D61E probably damaging Het
Mark2 T C 19: 7,284,716 D311G probably benign Het
Men1 C T 19: 6,338,293 S314L possibly damaging Het
Nxpe2 T C 9: 48,323,097 N290S possibly damaging Het
Olfr1458 T A 19: 13,103,246 probably null Het
Olfr452 T C 6: 42,790,654 V205A possibly damaging Het
Pcolce2 A T 9: 95,694,635 T320S probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phf21b G T 15: 84,791,835 P337H probably damaging Het
Pinlyp G T 7: 24,545,950 T15K probably damaging Het
Ppox A T 1: 171,277,948 S307R probably benign Het
Ptk7 T A 17: 46,586,461 E315V possibly damaging Het
Pxk T C 14: 8,144,233 I327T probably damaging Het
Rabgap1 A T 2: 37,563,479 K973I probably benign Het
Rbbp8 A T 18: 11,718,835 I238L probably benign Het
Runx2 T A 17: 44,735,555 D109V possibly damaging Het
Serpinb6a G A 13: 33,923,020 S183L probably benign Het
Sptlc3 T C 2: 139,625,875 I451T possibly damaging Het
Sugp1 A T 8: 70,056,503 Y142F possibly damaging Het
Sumf2 T C 5: 129,852,918 F98S probably damaging Het
Tmem120a C T 5: 135,742,366 E39K possibly damaging Het
Tnxb C T 17: 34,717,129 P2680L probably damaging Het
Zfp78 C G 7: 6,379,366 R472G possibly damaging Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
circus UTSW 9 87206862 missense probably damaging 1.00
moscow UTSW 9 87193697 missense probably damaging 1.00
smiley UTSW 9 87217081 nonsense probably null
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
R8351:Cep162 UTSW 9 87192850 nonsense probably null
R8451:Cep162 UTSW 9 87192850 nonsense probably null
R8552:Cep162 UTSW 9 87244308 missense probably benign 0.34
R8755:Cep162 UTSW 9 87232011 missense probably benign 0.02
R8762:Cep162 UTSW 9 87227261 missense probably benign 0.00
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACCAACAGGGGTATCTTGTGC -3'
(R):5'- TCTGAAGAGAAGGTATCCCAACTC -3'

Sequencing Primer
(F):5'- TGACTAGCCTGTCTGGAACAC -3'
(R):5'- GAGAAGGTATCCCAACTCTTTGC -3'
Posted On2020-09-15