Incidental Mutation 'R7949:Pcolce2'
ID649472
Institutional Source Beutler Lab
Gene Symbol Pcolce2
Ensembl Gene ENSMUSG00000015354
Gene Nameprocollagen C-endopeptidase enhancer 2
Synonyms2400001O18Rik, Pcpe2
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_029620.2; MGI:1923727

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7949 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location95637601-95698096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95694635 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 320 (T320S)
Ref Sequence ENSEMBL: ENSMUSP00000015498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015498]
Predicted Effect probably benign
Transcript: ENSMUST00000015498
AA Change: T320S

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000015498
Gene: ENSMUSG00000015354
AA Change: T320S

DomainStartEndE-ValueType
CUB 32 143 1.49e-41 SMART
CUB 153 267 2e-42 SMART
low complexity region 268 293 N/A INTRINSIC
C345C 307 412 4.1e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 3722112
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable abnormalities in thymus or T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,155,234 T6111M probably damaging Het
Adprhl1 T G 8: 13,224,225 R844S possibly damaging Het
Aldh1b1 A G 4: 45,802,807 E115G possibly damaging Het
Anp32a A G 9: 62,373,666 E170G unknown Het
Arhgap27 A G 11: 103,337,769 S349P probably damaging Het
Asns T A 6: 7,685,328 I110F probably damaging Het
Atad3a T C 4: 155,748,695 H437R possibly damaging Het
Atl2 C A 17: 79,859,860 R244L probably damaging Het
Bcl2l14 A T 6: 134,430,120 D222V probably damaging Het
Ccdc102a G T 8: 94,905,285 Q498K probably damaging Het
Cep162 T A 9: 87,206,848 M994L probably benign Het
Ddx18 A G 1: 121,555,318 Y580H probably damaging Het
Fer T A 17: 64,133,508 S707T probably damaging Het
Gabra6 A G 11: 42,316,999 V215A probably benign Het
Gm20671 A G 5: 32,819,944 V142A probably benign Het
Gm6614 C A 6: 141,994,265 G171C probably damaging Het
Gtf3c1 G T 7: 125,651,081 N1439K probably benign Het
Igbp1b T C 6: 138,658,416 K10R probably benign Het
Ighv5-8 TATATATATATATATATATATATA TATATATATATATATATATATATATA 12: 113,654,943 probably null Het
Igkv12-44 A T 6: 69,814,890 S30T probably benign Het
Immt A T 6: 71,874,343 R563* probably null Het
Jakmip1 A T 5: 37,182,148 Q1231L probably damaging Het
Jsrp1 T C 10: 80,812,072 T51A probably benign Het
Krtap31-1 A G 11: 99,908,318 T116A possibly damaging Het
Lrp8 T A 4: 107,803,327 D61E probably damaging Het
Mark2 T C 19: 7,284,716 D311G probably benign Het
Men1 C T 19: 6,338,293 S314L possibly damaging Het
Nxpe2 T C 9: 48,323,097 N290S possibly damaging Het
Olfr452 T C 6: 42,790,654 V205A possibly damaging Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phf21b G T 15: 84,791,835 P337H probably damaging Het
Pinlyp G T 7: 24,545,950 T15K probably damaging Het
Ppox A T 1: 171,277,948 S307R probably benign Het
Ptk7 T A 17: 46,586,461 E315V possibly damaging Het
Pxk T C 14: 8,144,233 I327T probably damaging Het
Rabgap1 A T 2: 37,563,479 K973I probably benign Het
Rbbp8 A T 18: 11,718,835 I238L probably benign Het
Runx2 T A 17: 44,735,555 D109V possibly damaging Het
Serpinb6a G A 13: 33,923,020 S183L probably benign Het
Sptlc3 T C 2: 139,625,875 I451T possibly damaging Het
Sugp1 A T 8: 70,056,503 Y142F possibly damaging Het
Sumf2 T C 5: 129,852,918 F98S probably damaging Het
Tmem120a C T 5: 135,742,366 E39K possibly damaging Het
Tnxb C T 17: 34,717,129 P2680L probably damaging Het
Zfp78 C G 7: 6,379,366 R472G possibly damaging Het
Other mutations in Pcolce2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pcolce2 APN 9 95692923 missense probably damaging 0.98
IGL03339:Pcolce2 APN 9 95678340 splice site probably benign
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0570:Pcolce2 UTSW 9 95638657 missense probably benign 0.00
R0962:Pcolce2 UTSW 9 95670034 missense probably benign 0.04
R0989:Pcolce2 UTSW 9 95638723 missense probably benign 0.00
R1171:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R1840:Pcolce2 UTSW 9 95670117 missense probably damaging 0.98
R1840:Pcolce2 UTSW 9 95670203 missense probably benign 0.16
R1997:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R2061:Pcolce2 UTSW 9 95670176 missense probably benign 0.04
R2196:Pcolce2 UTSW 9 95694689 missense probably damaging 0.98
R2287:Pcolce2 UTSW 9 95678405 nonsense probably null
R2922:Pcolce2 UTSW 9 95694714 missense probably damaging 1.00
R4049:Pcolce2 UTSW 9 95638755 missense probably damaging 1.00
R4432:Pcolce2 UTSW 9 95681557 missense probably damaging 0.99
R4639:Pcolce2 UTSW 9 95637877 splice site probably null
R6288:Pcolce2 UTSW 9 95681593 missense probably damaging 0.96
R6625:Pcolce2 UTSW 9 95678439 nonsense probably null
R6883:Pcolce2 UTSW 9 95678343 critical splice acceptor site probably null
R7023:Pcolce2 UTSW 9 95678468 missense probably benign 0.19
R7066:Pcolce2 UTSW 9 95681621 missense probably benign
R8325:Pcolce2 UTSW 9 95692920 missense probably damaging 1.00
R8369:Pcolce2 UTSW 9 95637794 start codon destroyed probably benign
R8510:Pcolce2 UTSW 9 95681647 missense probably damaging 0.98
Z1176:Pcolce2 UTSW 9 95637836 missense possibly damaging 0.83
Z1177:Pcolce2 UTSW 9 95678425 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CAGACTGCAGTTGGGAAAGC -3'
(R):5'- GGCTACAGCTCTGTCCTTAC -3'

Sequencing Primer
(F):5'- GAAAGCAGCCAGATTTCTCTTCTG -3'
(R):5'- GTCCTTACCTCGTCTGAGAAGG -3'
Posted On2020-09-15