Incidental Mutation 'R7949:Ptk7'
ID649484
Institutional Source Beutler Lab
Gene Symbol Ptk7
Ensembl Gene ENSMUSG00000023972
Gene NamePTK7 protein tyrosine kinase 7
Synonyms8430404F20Rik, mPTK7/CCK4, chz
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7949 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46564451-46629504 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46586461 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 315 (E315V)
Ref Sequence ENSEMBL: ENSMUSP00000043703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044442]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044442
AA Change: E315V

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: E315V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,293,595 probably null Het
Adgrv1 G A 13: 81,155,234 T6111M probably damaging Het
Adprhl1 T G 8: 13,224,225 R844S possibly damaging Het
Aldh1b1 A G 4: 45,802,807 E115G possibly damaging Het
Anp32a A G 9: 62,373,666 E170G unknown Het
Arhgap27 A G 11: 103,337,769 S349P probably damaging Het
Asns T A 6: 7,685,328 I110F probably damaging Het
Atad3a T C 4: 155,748,695 H437R possibly damaging Het
Atl2 C A 17: 79,859,860 R244L probably damaging Het
Bcl2l14 A T 6: 134,430,120 D222V probably damaging Het
Ccdc102a G T 8: 94,905,285 Q498K probably damaging Het
Cdc14b T C 13: 64,190,398 probably null Het
Cep162 T A 9: 87,206,848 M994L probably benign Het
Ddx18 A G 1: 121,555,318 Y580H probably damaging Het
Entpd6 C A 2: 150,770,277 probably null Het
Fer T A 17: 64,133,508 S707T probably damaging Het
Gabra6 A G 11: 42,316,999 V215A probably benign Het
Gm20671 A G 5: 32,819,944 V142A probably benign Het
Gm6614 C A 6: 141,994,265 G171C probably damaging Het
Gtf3c1 G T 7: 125,651,081 N1439K probably benign Het
Igbp1b T C 6: 138,658,416 K10R probably benign Het
Ighv5-8 TATATATATATATATATATATATA TATATATATATATATATATATATATA 12: 113,654,943 probably null Het
Igkv12-44 A T 6: 69,814,890 S30T probably benign Het
Immt A T 6: 71,874,343 R563* probably null Het
Jakmip1 A T 5: 37,182,148 Q1231L probably damaging Het
Jsrp1 T C 10: 80,812,072 T51A probably benign Het
Krtap31-1 A G 11: 99,908,318 T116A possibly damaging Het
Lrp8 T A 4: 107,803,327 D61E probably damaging Het
Mark2 T C 19: 7,284,716 D311G probably benign Het
Men1 C T 19: 6,338,293 S314L possibly damaging Het
Nxpe2 T C 9: 48,323,097 N290S possibly damaging Het
Olfr1458 T A 19: 13,103,246 probably null Het
Olfr452 T C 6: 42,790,654 V205A possibly damaging Het
Pcolce2 A T 9: 95,694,635 T320S probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phf21b G T 15: 84,791,835 P337H probably damaging Het
Pinlyp G T 7: 24,545,950 T15K probably damaging Het
Ppox A T 1: 171,277,948 S307R probably benign Het
Pxk T C 14: 8,144,233 I327T probably damaging Het
Rabgap1 A T 2: 37,563,479 K973I probably benign Het
Rbbp8 A T 18: 11,718,835 I238L probably benign Het
Runx2 T A 17: 44,735,555 D109V possibly damaging Het
Serpinb6a G A 13: 33,923,020 S183L probably benign Het
Sptlc3 T C 2: 139,625,875 I451T possibly damaging Het
Sugp1 A T 8: 70,056,503 Y142F possibly damaging Het
Sumf2 T C 5: 129,852,918 F98S probably damaging Het
Tmem120a C T 5: 135,742,366 E39K possibly damaging Het
Tnxb C T 17: 34,717,129 P2680L probably damaging Het
Zfp78 C G 7: 6,379,366 R472G possibly damaging Het
Other mutations in Ptk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ptk7 APN 17 46574427 missense probably damaging 1.00
IGL01064:Ptk7 APN 17 46573566 nonsense probably null
IGL01444:Ptk7 APN 17 46565387 missense probably damaging 1.00
IGL01477:Ptk7 APN 17 46576880 missense possibly damaging 0.61
IGL01727:Ptk7 APN 17 46572548 missense probably damaging 1.00
IGL01958:Ptk7 APN 17 46579427 missense probably benign 0.37
IGL02496:Ptk7 APN 17 46590144 missense probably benign 0.04
IGL02864:Ptk7 APN 17 46572733 missense probably damaging 1.00
R0008:Ptk7 UTSW 17 46572762 splice site probably benign
R0671:Ptk7 UTSW 17 46590312 missense possibly damaging 0.94
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1549:Ptk7 UTSW 17 46572652 missense probably damaging 1.00
R1635:Ptk7 UTSW 17 46573534 missense possibly damaging 0.81
R1646:Ptk7 UTSW 17 46586297 missense probably benign 0.44
R1846:Ptk7 UTSW 17 46576490 critical splice donor site probably null
R1973:Ptk7 UTSW 17 46586807 nonsense probably null
R2060:Ptk7 UTSW 17 46566238 missense possibly damaging 0.83
R2155:Ptk7 UTSW 17 46579617 missense probably benign 0.09
R2472:Ptk7 UTSW 17 46576848 missense probably benign 0.35
R2937:Ptk7 UTSW 17 46572550 missense probably damaging 0.99
R3824:Ptk7 UTSW 17 46565378 missense probably damaging 1.00
R3845:Ptk7 UTSW 17 46586418 missense probably benign 0.00
R4222:Ptk7 UTSW 17 46574463 missense probably benign
R4671:Ptk7 UTSW 17 46574466 missense probably benign
R4922:Ptk7 UTSW 17 46576491 critical splice donor site probably null
R5319:Ptk7 UTSW 17 46572677 missense probably damaging 1.00
R5993:Ptk7 UTSW 17 46565370 missense probably benign
R6254:Ptk7 UTSW 17 46572642 missense probably damaging 1.00
R6352:Ptk7 UTSW 17 46576890 missense probably benign 0.00
R6806:Ptk7 UTSW 17 46573528 missense probably damaging 0.99
R7338:Ptk7 UTSW 17 46579599 missense probably benign 0.00
R7394:Ptk7 UTSW 17 46591757 missense probably damaging 1.00
R7709:Ptk7 UTSW 17 46571643 missense possibly damaging 0.81
R8773:Ptk7 UTSW 17 46566267 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTGCATGGCAGGTGTAGACAC -3'
(R):5'- GCTCGTGTTTGAATTAGATAGCAGC -3'

Sequencing Primer
(F):5'- AGTATCACTCTCAGCGATGGTGAC -3'
(R):5'- TTTGAATTAGATAGCAGCTTGGAGAG -3'
Posted On2020-09-15