Incidental Mutation 'R7950:Ecel1'
ID649492
Institutional Source Beutler Lab
Gene Symbol Ecel1
Ensembl Gene ENSMUSG00000026247
Gene Nameendothelin converting enzyme-like 1
SynonymsXCE, DINE
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7950 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87147655-87156521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87148269 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 729 (Y729N)
Ref Sequence ENSEMBL: ENSMUSP00000027463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027463] [ENSMUST00000160810] [ENSMUST00000161002]
Predicted Effect probably damaging
Transcript: ENSMUST00000027463
AA Change: Y729N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027463
Gene: ENSMUSG00000026247
AA Change: Y729N

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 6.4e-112 PFAM
Pfam:Peptidase_M13 571 774 5.2e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160810
AA Change: Y729N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125557
Gene: ENSMUSG00000026247
AA Change: Y729N

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 1.2e-98 PFAM
Pfam:Peptidase_M13 571 774 2.3e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161002
AA Change: Y729N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125096
Gene: ENSMUSG00000026247
AA Change: Y729N

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 6.4e-112 PFAM
Pfam:Peptidase_M13 571 774 5.2e-66 PFAM
Meta Mutation Damage Score 0.2653 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M13 family of endopeptidases. Members of this family are zinc-containing type II integral-membrane proteins that are important regulators of neuropeptide and peptide hormone activity. Mutations in this gene are associated with autosomal recessive distal arthrogryposis, type 5D. This gene has multiple pseudogenes on chromosome 2. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Targeted mutations of this gene result in respiratory distress causing neonatal lethality due to reduced diaphram innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,979,767 T31I probably damaging Het
Adgrf5 G A 17: 43,451,157 V1248M probably damaging Het
Alb T C 5: 90,472,464 S478P probably damaging Het
Arhgap17 A G 7: 123,286,816 S698P probably benign Het
Arhgef5 A G 6: 43,273,925 T537A possibly damaging Het
Arl6 A T 16: 59,618,731 probably null Het
Atp13a4 A T 16: 29,449,917 W540R Het
Birc6 A T 17: 74,593,100 D1091V probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
C130074G19Rik T C 1: 184,874,374 probably null Het
C1ql4 T A 15: 99,084,812 H220L probably benign Het
Cacna1s A G 1: 136,100,625 N1147S probably benign Het
Cc2d2a T C 5: 43,695,296 probably null Het
Ccdc36 T C 9: 108,405,671 T273A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Epha4 T A 1: 77,507,196 I59F probably damaging Het
Filip1l A G 16: 57,569,711 K221E probably damaging Het
Flnc A G 6: 29,456,382 E2193G possibly damaging Het
Galnt10 C G 11: 57,783,723 P513A probably damaging Het
Gm5624 A G 14: 44,560,733 Y139H Het
Golgb1 A C 16: 36,915,424 I1719L probably benign Het
Hsf1 T C 15: 76,498,193 S255P probably benign Het
Ighv2-2 T C 12: 113,588,294 D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 Q10* probably null Het
Kcnh2 C T 5: 24,333,036 V110M probably benign Het
Magi3 A C 3: 104,016,689 L1112W probably damaging Het
Malrd1 T A 2: 16,128,068 D1933E unknown Het
Mki67 G A 7: 135,699,724 R1194* probably null Het
Nap1l1 T C 10: 111,492,908 Y233H probably damaging Het
Napsa A G 7: 44,585,334 I298V probably benign Het
Nkx6-1 A T 5: 101,663,599 S212R probably damaging Het
Nlrc4 A T 17: 74,445,615 I591N probably damaging Het
Olfr1468-ps1 T C 19: 13,375,067 I35T possibly damaging Het
Orc2 T C 1: 58,467,668 D503G possibly damaging Het
Osbp T A 19: 11,978,248 S343T probably benign Het
Pcdha6 T G 18: 36,969,426 D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Ppdpf A G 2: 181,187,857 Y35C probably benign Het
Scrn2 T A 11: 97,030,929 L75Q probably damaging Het
Scube3 G A 17: 28,171,226 V955I probably benign Het
Slc1a1 T C 19: 28,911,761 V478A probably benign Het
Slc4a4 A G 5: 89,058,278 probably null Het
Srrm2 T C 17: 23,808,110 L96P unknown Het
Strn A T 17: 78,670,423 L175Q Het
Other mutations in Ecel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Ecel1 APN 1 87153193 missense possibly damaging 0.84
IGL01431:Ecel1 APN 1 87151504 missense probably damaging 0.99
IGL01992:Ecel1 APN 1 87149855 splice site probably benign
IGL02040:Ecel1 APN 1 87154923 missense probably benign 0.32
IGL02230:Ecel1 APN 1 87152194 missense probably damaging 1.00
IGL02801:Ecel1 APN 1 87152003 missense probably damaging 1.00
Capulin UTSW 1 87153301 missense probably damaging 0.99
R0139:Ecel1 UTSW 1 87154526 missense possibly damaging 0.95
R1723:Ecel1 UTSW 1 87154421 missense probably benign 0.37
R2118:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2119:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2120:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2122:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R3815:Ecel1 UTSW 1 87152900 missense probably damaging 0.97
R3836:Ecel1 UTSW 1 87150656 missense probably damaging 1.00
R4211:Ecel1 UTSW 1 87152150 missense probably damaging 1.00
R4685:Ecel1 UTSW 1 87152946 splice site probably null
R4841:Ecel1 UTSW 1 87153301 missense probably damaging 0.99
R4842:Ecel1 UTSW 1 87153301 missense probably damaging 0.99
R4888:Ecel1 UTSW 1 87148727 splice site probably benign
R4976:Ecel1 UTSW 1 87151139 missense probably benign 0.17
R5032:Ecel1 UTSW 1 87154253 missense probably damaging 0.97
R5119:Ecel1 UTSW 1 87151139 missense probably benign 0.17
R5393:Ecel1 UTSW 1 87152876 missense possibly damaging 0.95
R5798:Ecel1 UTSW 1 87151483 missense probably damaging 1.00
R5862:Ecel1 UTSW 1 87149596 missense probably benign 0.19
R5874:Ecel1 UTSW 1 87148009 missense probably benign 0.24
R6341:Ecel1 UTSW 1 87150471 splice site probably null
R6351:Ecel1 UTSW 1 87149509 missense possibly damaging 0.56
R6534:Ecel1 UTSW 1 87154842 missense probably benign 0.13
R7405:Ecel1 UTSW 1 87153516 critical splice donor site probably null
R7422:Ecel1 UTSW 1 87149612 missense probably damaging 1.00
R7850:Ecel1 UTSW 1 87152023 missense probably damaging 1.00
R7939:Ecel1 UTSW 1 87149534 missense probably benign 0.19
R8022:Ecel1 UTSW 1 87153330 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TTCCTCAAACTGGGATACGC -3'
(R):5'- TCACATGAGCATCTCCAGGG -3'

Sequencing Primer
(F):5'- TCAAACTGGGATACGCTGCCC -3'
(R):5'- TGAGCATCTCCAGGGCTCAG -3'
Posted On2020-09-15