Incidental Mutation 'R7950:Malrd1'
ID 649494
Institutional Source Beutler Lab
Gene Symbol Malrd1
Ensembl Gene ENSMUSG00000075520
Gene Name MAM and LDL receptor class A domain containing 1
Synonyms Gm13364, Gm13318, Diet1
MMRRC Submission 045995-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7950 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 15531290-16260366 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 16132879 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1933 (D1933E)
Ref Sequence ENSEMBL: ENSMUSP00000116869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146205]
AlphaFold A2AJX4
Predicted Effect unknown
Transcript: ENSMUST00000146205
AA Change: D1933E
SMART Domains Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: D1933E

DomainStartEndE-ValueType
Pfam:MAM 8 171 1.6e-36 PFAM
LDLa 181 219 6.89e-8 SMART
LDLa 225 262 4.37e-10 SMART
LDLa 264 303 9.55e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,762,048 (GRCm39) V1248M probably damaging Het
Alb T C 5: 90,620,323 (GRCm39) S478P probably damaging Het
Arhgap17 A G 7: 122,886,039 (GRCm39) S698P probably benign Het
Arhgef5 A G 6: 43,250,859 (GRCm39) T537A possibly damaging Het
Arl6 A T 16: 59,439,094 (GRCm39) probably null Het
Atp13a4 A T 16: 29,268,735 (GRCm39) W540R Het
Birc6 A T 17: 74,900,095 (GRCm39) D1091V probably damaging Het
Bnc1 A G 7: 81,623,250 (GRCm39) V659A probably benign Het
C130074G19Rik T C 1: 184,606,571 (GRCm39) probably null Het
C1ql4 T A 15: 98,982,693 (GRCm39) H220L probably benign Het
Cacna1s A G 1: 136,028,363 (GRCm39) N1147S probably benign Het
Cc2d2a T C 5: 43,852,638 (GRCm39) probably null Het
Ccl1 T A 11: 82,070,519 (GRCm39) I18L probably benign Het
Cfap410 C T 10: 77,815,601 (GRCm39) T31I probably damaging Het
Ecel1 A T 1: 87,075,991 (GRCm39) Y729N probably damaging Het
Epha4 T A 1: 77,483,833 (GRCm39) I59F probably damaging Het
Filip1l A G 16: 57,390,074 (GRCm39) K221E probably damaging Het
Flnc A G 6: 29,456,381 (GRCm39) E2193G possibly damaging Het
Galnt10 C G 11: 57,674,549 (GRCm39) P513A probably damaging Het
Gm5624 A G 14: 44,798,190 (GRCm39) Y139H Het
Golgb1 A C 16: 36,735,786 (GRCm39) I1719L probably benign Het
Hsf1 T C 15: 76,382,393 (GRCm39) S255P probably benign Het
Ighv2-2 T C 12: 113,551,914 (GRCm39) D108G probably damaging Het
Iho1 T C 9: 108,282,870 (GRCm39) T273A probably benign Het
Kbtbd3 C T 9: 4,316,878 (GRCm39) Q10* probably null Het
Kcnh2 C T 5: 24,538,034 (GRCm39) V110M probably benign Het
Magi3 A C 3: 103,924,005 (GRCm39) L1112W probably damaging Het
Mki67 G A 7: 135,301,453 (GRCm39) R1194* probably null Het
Nap1l1 T C 10: 111,328,769 (GRCm39) Y233H probably damaging Het
Napsa A G 7: 44,234,758 (GRCm39) I298V probably benign Het
Nkx6-1 A T 5: 101,811,465 (GRCm39) S212R probably damaging Het
Nlrc4 A T 17: 74,752,610 (GRCm39) I591N probably damaging Het
Or5b114-ps1 T C 19: 13,352,431 (GRCm39) I35T possibly damaging Het
Orc2 T C 1: 58,506,827 (GRCm39) D503G possibly damaging Het
Osbp T A 19: 11,955,612 (GRCm39) S343T probably benign Het
Pcdha6 T G 18: 37,102,479 (GRCm39) D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,101,876 (GRCm39) probably benign Het
Ppdpf A G 2: 180,829,650 (GRCm39) Y35C probably benign Het
Scrn2 T A 11: 96,921,755 (GRCm39) L75Q probably damaging Het
Scube3 G A 17: 28,390,200 (GRCm39) V955I probably benign Het
Slc1a1 T C 19: 28,889,161 (GRCm39) V478A probably benign Het
Slc4a4 A G 5: 89,206,137 (GRCm39) probably null Het
Srrm2 T C 17: 24,027,084 (GRCm39) L96P unknown Het
Strn A T 17: 78,977,852 (GRCm39) L175Q Het
Other mutations in Malrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Malrd1 APN 2 16,146,997 (GRCm39) splice site probably benign
IGL01295:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01296:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01399:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01400:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01401:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01402:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01405:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01406:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL02105:Malrd1 APN 2 16,132,674 (GRCm39) missense unknown
IGL02581:Malrd1 APN 2 16,147,123 (GRCm39) nonsense probably null
IGL03015:Malrd1 APN 2 16,047,082 (GRCm39) missense unknown
IGL03038:Malrd1 APN 2 16,132,778 (GRCm39) missense unknown
R1353:Malrd1 UTSW 2 16,132,779 (GRCm39) missense unknown
R1385:Malrd1 UTSW 2 16,047,039 (GRCm39) missense unknown
R2242:Malrd1 UTSW 2 16,106,755 (GRCm39) missense unknown
R2888:Malrd1 UTSW 2 16,079,568 (GRCm39) missense unknown
R4398:Malrd1 UTSW 2 16,155,594 (GRCm39) missense unknown
R4982:Malrd1 UTSW 2 16,046,940 (GRCm39) missense probably benign 0.29
R5148:Malrd1 UTSW 2 16,147,037 (GRCm39) missense unknown
R5195:Malrd1 UTSW 2 16,155,621 (GRCm39) missense unknown
R5828:Malrd1 UTSW 2 15,531,464 (GRCm39) missense probably benign 0.00
R5892:Malrd1 UTSW 2 15,619,078 (GRCm39) missense probably benign 0.03
R6034:Malrd1 UTSW 2 15,850,137 (GRCm39) missense possibly damaging 0.78
R6034:Malrd1 UTSW 2 15,850,137 (GRCm39) missense possibly damaging 0.78
R6195:Malrd1 UTSW 2 15,700,137 (GRCm39) missense probably damaging 1.00
R6318:Malrd1 UTSW 2 16,047,078 (GRCm39) missense unknown
R6438:Malrd1 UTSW 2 15,619,017 (GRCm39) missense
R6457:Malrd1 UTSW 2 15,672,740 (GRCm39) missense probably benign 0.41
R6457:Malrd1 UTSW 2 15,531,408 (GRCm39) start gained probably benign
R6499:Malrd1 UTSW 2 15,936,500 (GRCm39) missense probably benign 0.03
R6575:Malrd1 UTSW 2 15,847,439 (GRCm39) missense probably benign 0.00
R6792:Malrd1 UTSW 2 16,155,567 (GRCm39) missense unknown
R6796:Malrd1 UTSW 2 15,874,595 (GRCm39) missense unknown
R6930:Malrd1 UTSW 2 15,802,478 (GRCm39) missense unknown
R6959:Malrd1 UTSW 2 16,222,820 (GRCm39) missense probably damaging 0.97
R6993:Malrd1 UTSW 2 16,155,602 (GRCm39) missense unknown
R7102:Malrd1 UTSW 2 16,147,114 (GRCm39) missense unknown
R7112:Malrd1 UTSW 2 15,929,987 (GRCm39) missense unknown
R7248:Malrd1 UTSW 2 16,106,722 (GRCm39) missense unknown
R7249:Malrd1 UTSW 2 15,628,151 (GRCm39) missense probably damaging 0.97
R7334:Malrd1 UTSW 2 16,011,529 (GRCm39) missense probably damaging 0.99
R7394:Malrd1 UTSW 2 15,700,010 (GRCm39) missense unknown
R7399:Malrd1 UTSW 2 15,614,901 (GRCm39) missense
R7476:Malrd1 UTSW 2 16,147,115 (GRCm39) missense unknown
R7582:Malrd1 UTSW 2 15,700,081 (GRCm39) missense unknown
R7604:Malrd1 UTSW 2 15,930,003 (GRCm39) missense unknown
R7662:Malrd1 UTSW 2 15,876,265 (GRCm39) missense unknown
R7681:Malrd1 UTSW 2 16,222,913 (GRCm39) missense unknown
R7740:Malrd1 UTSW 2 15,619,026 (GRCm39) missense not run
R7747:Malrd1 UTSW 2 16,079,646 (GRCm39) missense unknown
R7754:Malrd1 UTSW 2 15,802,610 (GRCm39) splice site probably null
R8194:Malrd1 UTSW 2 15,929,931 (GRCm39) missense unknown
R8260:Malrd1 UTSW 2 15,619,017 (GRCm39) missense
R8314:Malrd1 UTSW 2 15,757,643 (GRCm39) missense unknown
R8342:Malrd1 UTSW 2 15,638,035 (GRCm39) missense unknown
R8386:Malrd1 UTSW 2 15,701,655 (GRCm39) missense unknown
R8492:Malrd1 UTSW 2 15,614,934 (GRCm39) missense
R8728:Malrd1 UTSW 2 15,701,753 (GRCm39) nonsense probably null
R8756:Malrd1 UTSW 2 15,757,706 (GRCm39) critical splice donor site probably null
R8869:Malrd1 UTSW 2 15,570,368 (GRCm39) critical splice donor site probably null
R8888:Malrd1 UTSW 2 15,850,038 (GRCm39) missense unknown
R8895:Malrd1 UTSW 2 15,850,038 (GRCm39) missense unknown
R8902:Malrd1 UTSW 2 16,260,145 (GRCm39) nonsense probably null
R8954:Malrd1 UTSW 2 15,556,178 (GRCm39) missense
R8960:Malrd1 UTSW 2 15,570,241 (GRCm39) nonsense probably null
R9005:Malrd1 UTSW 2 15,850,140 (GRCm39) missense unknown
R9135:Malrd1 UTSW 2 15,802,516 (GRCm39) missense unknown
R9267:Malrd1 UTSW 2 16,260,077 (GRCm39) missense unknown
R9330:Malrd1 UTSW 2 16,260,089 (GRCm39) missense unknown
R9359:Malrd1 UTSW 2 15,618,988 (GRCm39) missense
R9383:Malrd1 UTSW 2 15,700,012 (GRCm39) missense unknown
R9389:Malrd1 UTSW 2 15,707,967 (GRCm39) missense unknown
R9403:Malrd1 UTSW 2 15,618,988 (GRCm39) missense
R9454:Malrd1 UTSW 2 15,802,537 (GRCm39) nonsense probably null
R9454:Malrd1 UTSW 2 15,757,660 (GRCm39) missense unknown
R9520:Malrd1 UTSW 2 16,079,631 (GRCm39) missense unknown
R9544:Malrd1 UTSW 2 15,640,809 (GRCm39) missense unknown
R9609:Malrd1 UTSW 2 15,700,081 (GRCm39) missense unknown
R9667:Malrd1 UTSW 2 15,570,026 (GRCm39) critical splice acceptor site probably null
R9721:Malrd1 UTSW 2 15,701,638 (GRCm39) missense unknown
R9787:Malrd1 UTSW 2 15,625,401 (GRCm39) missense unknown
R9800:Malrd1 UTSW 2 15,847,405 (GRCm39) missense unknown
Z1176:Malrd1 UTSW 2 16,222,656 (GRCm39) missense unknown
Z1191:Malrd1 UTSW 2 16,047,037 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTGTATCTACGCACTCCAG -3'
(R):5'- AGCCCTTCTAGACATGGAAAG -3'

Sequencing Primer
(F):5'- CCAGTGTGTCTCTGCTTCAG -3'
(R):5'- CCCTTCTAGACATGGAAAGCAAGAG -3'
Posted On 2020-09-15