Mutagenetix > Incidental Mutations

Incidental Mutation 'R7950:Malrd1'

649494

Institutional Source

Beutler Lab

Gene Symbol

Malrd1

Ensembl Gene

ENSMUSG00000075520

Gene Name

MAM and LDL receptor class A domain containing 1

Synonyms

Diet1, Gm13364, Gm13318

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R7950 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15526479-16255555 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 16128068 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1933 (D1933E)

Ref Sequence

ENSEMBL: ENSMUSP00000116869 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146205]

Predicted Effect

unknown
Transcript: ENSMUST00000146205
AA Change: D1933E

SMART Domains

Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: D1933E

Domain	Start	End	E-Value	Type
Pfam:MAM	8	171	1.6e-36	PFAM
LDLa	181	219	6.89e-8	SMART
LDLa	225	262	4.37e-10	SMART
LDLa	264	303	9.55e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,979,767	T31I	probably damaging	Het
Adgrf5	G	A	17: 43,451,157	V1248M	probably damaging	Het
Alb	T	C	5: 90,472,464	S478P	probably damaging	Het
Arhgap17	A	G	7: 123,286,816	S698P	probably benign	Het
Arhgef5	A	G	6: 43,273,925	T537A	possibly damaging	Het
Arl6	A	T	16: 59,618,731		probably null	Het
Atp13a4	A	T	16: 29,449,917	W540R		Het
Birc6	A	T	17: 74,593,100	D1091V	probably damaging	Het
Bnc1	A	G	7: 81,973,502	V659A	probably benign	Het
C130074G19Rik	T	C	1: 184,874,374		probably null	Het
C1ql4	T	A	15: 99,084,812	H220L	probably benign	Het
Cacna1s	A	G	1: 136,100,625	N1147S	probably benign	Het
Cc2d2a	T	C	5: 43,695,296		probably null	Het
Ccdc36	T	C	9: 108,405,671	T273A	probably benign	Het
Ccl1	T	A	11: 82,179,693	I18L	probably benign	Het
Ecel1	A	T	1: 87,148,269	Y729N	probably damaging	Het
Epha4	T	A	1: 77,507,196	I59F	probably damaging	Het
Filip1l	A	G	16: 57,569,711	K221E	probably damaging	Het
Flnc	A	G	6: 29,456,382	E2193G	possibly damaging	Het
Galnt10	C	G	11: 57,783,723	P513A	probably damaging	Het
Gm5624	A	G	14: 44,560,733	Y139H		Het
Golgb1	A	C	16: 36,915,424	I1719L	probably benign	Het
Hsf1	T	C	15: 76,498,193	S255P	probably benign	Het
Ighv2-2	T	C	12: 113,588,294	D108G	probably damaging	Het
Kbtbd3	C	T	9: 4,316,878	Q10*	probably null	Het
Kcnh2	C	T	5: 24,333,036	V110M	probably benign	Het
Magi3	A	C	3: 104,016,689	L1112W	probably damaging	Het
Mki67	G	A	7: 135,699,724	R1194*	probably null	Het
Nap1l1	T	C	10: 111,492,908	Y233H	probably damaging	Het
Napsa	A	G	7: 44,585,334	I298V	probably benign	Het
Nkx6-1	A	T	5: 101,663,599	S212R	probably damaging	Het
Nlrc4	A	T	17: 74,445,615	I591N	probably damaging	Het
Olfr1468-ps1	T	C	19: 13,375,067	I35T	possibly damaging	Het
Orc2	T	C	1: 58,467,668	D503G	possibly damaging	Het
Osbp	T	A	19: 11,978,248	S343T	probably benign	Het
Pcdha6	T	G	18: 36,969,426	D557E	probably damaging	Het
Pdcd11	AGAGGAGGAGGAGGAGGAGGAGGAG	AGAGGAGGAGGAGGAGGAGGAG	19: 47,113,437		probably benign	Het
Ppdpf	A	G	2: 181,187,857	Y35C	probably benign	Het
Scrn2	T	A	11: 97,030,929	L75Q	probably damaging	Het
Scube3	G	A	17: 28,171,226	V955I	probably benign	Het
Slc1a1	T	C	19: 28,911,761	V478A	probably benign	Het
Slc4a4	A	G	5: 89,058,278		probably null	Het
Srrm2	T	C	17: 23,808,110	L96P	unknown	Het
Strn	A	T	17: 78,670,423	L175Q		Het

Other mutations in Malrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Malrd1	APN	2	16142186	splice site	probably benign
IGL01295:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01296:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01399:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01400:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01401:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01402:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01405:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01406:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL02105:Malrd1	APN	2	16127863	missense	unknown
IGL02581:Malrd1	APN	2	16142312	nonsense	probably null
IGL03015:Malrd1	APN	2	16042271	missense	unknown
IGL03038:Malrd1	APN	2	16127967	missense	unknown
R1353:Malrd1	UTSW	2	16127968	missense	unknown
R1385:Malrd1	UTSW	2	16042228	missense	unknown
R2242:Malrd1	UTSW	2	16101944	missense	unknown
R2888:Malrd1	UTSW	2	16074757	missense	unknown
R4398:Malrd1	UTSW	2	16150783	missense	unknown
R4982:Malrd1	UTSW	2	16042129	missense	probably benign	0.29
R5148:Malrd1	UTSW	2	16142226	missense	unknown
R5195:Malrd1	UTSW	2	16150810	missense	unknown
R5828:Malrd1	UTSW	2	15526653	missense	probably benign	0.00
R5892:Malrd1	UTSW	2	15614267	missense	probably benign	0.03
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6195:Malrd1	UTSW	2	15695326	missense	probably damaging	1.00
R6318:Malrd1	UTSW	2	16042267	missense	unknown
R6438:Malrd1	UTSW	2	15614206	missense
R6457:Malrd1	UTSW	2	15526597	start gained	probably benign
R6457:Malrd1	UTSW	2	15667929	missense	probably benign	0.41
R6499:Malrd1	UTSW	2	15931689	missense	probably benign	0.03
R6575:Malrd1	UTSW	2	15842628	missense	probably benign	0.00
R6792:Malrd1	UTSW	2	16150756	missense	unknown
R6796:Malrd1	UTSW	2	15869784	missense	unknown
R6930:Malrd1	UTSW	2	15797667	missense	unknown
R6959:Malrd1	UTSW	2	16218009	missense	probably damaging	0.97
R6993:Malrd1	UTSW	2	16150791	missense	unknown
R7102:Malrd1	UTSW	2	16142303	missense	unknown
R7112:Malrd1	UTSW	2	15925176	missense	unknown
R7248:Malrd1	UTSW	2	16101911	missense	unknown
R7249:Malrd1	UTSW	2	15623340	missense	probably damaging	0.97
R7334:Malrd1	UTSW	2	16006718	missense	probably damaging	0.99
R7394:Malrd1	UTSW	2	15695199	missense	unknown
R7399:Malrd1	UTSW	2	15610090	missense
R7476:Malrd1	UTSW	2	16142304	missense	unknown
R7582:Malrd1	UTSW	2	15695270	missense	unknown
R7604:Malrd1	UTSW	2	15925192	missense	unknown
R7662:Malrd1	UTSW	2	15871454	missense	unknown
R7681:Malrd1	UTSW	2	16218102	missense	unknown
R7740:Malrd1	UTSW	2	15614215	missense	not run
R7747:Malrd1	UTSW	2	16074835	missense	unknown
R7754:Malrd1	UTSW	2	15797799	splice site	probably null
R8194:Malrd1	UTSW	2	15925120	missense	unknown
R8260:Malrd1	UTSW	2	15614206	missense
R8314:Malrd1	UTSW	2	15752832	missense	unknown
R8342:Malrd1	UTSW	2	15633224	missense	unknown
R8386:Malrd1	UTSW	2	15696844	missense	unknown
Z1176:Malrd1	UTSW	2	16217845	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCTTGTATCTACGCACTCCAG -3'
(R):5'- AGCCCTTCTAGACATGGAAAG -3'

Sequencing Primer
(F):5'- CCAGTGTGTCTCTGCTTCAG -3'
(R):5'- CCCTTCTAGACATGGAAAGCAAGAG -3'

Posted On

2020-09-15