Incidental Mutation 'R7950:Ppdpf'
ID649495
Institutional Source Beutler Lab
Gene Symbol Ppdpf
Ensembl Gene ENSMUSG00000016344
Gene Namepancreatic progenitor cell differentiation and proliferation factor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7950 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181187247-181188771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181187857 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 35 (Y35C)
Ref Sequence ENSEMBL: ENSMUSP00000016488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016488] [ENSMUST00000108841]
Predicted Effect probably benign
Transcript: ENSMUST00000016488
AA Change: Y35C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000016488
Gene: ENSMUSG00000016344
AA Change: Y35C

DomainStartEndE-ValueType
Pfam:PPDFL 1 111 4.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108841
AA Change: Y35C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104469
Gene: ENSMUSG00000016344
AA Change: Y35C

DomainStartEndE-ValueType
Pfam:PPDFL 1 112 1.1e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,979,767 T31I probably damaging Het
Adgrf5 G A 17: 43,451,157 V1248M probably damaging Het
Alb T C 5: 90,472,464 S478P probably damaging Het
Arhgap17 A G 7: 123,286,816 S698P probably benign Het
Arhgef5 A G 6: 43,273,925 T537A possibly damaging Het
Arl6 A T 16: 59,618,731 probably null Het
Atp13a4 A T 16: 29,449,917 W540R Het
Birc6 A T 17: 74,593,100 D1091V probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
C130074G19Rik T C 1: 184,874,374 probably null Het
C1ql4 T A 15: 99,084,812 H220L probably benign Het
Cacna1s A G 1: 136,100,625 N1147S probably benign Het
Cc2d2a T C 5: 43,695,296 probably null Het
Ccdc36 T C 9: 108,405,671 T273A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Ecel1 A T 1: 87,148,269 Y729N probably damaging Het
Epha4 T A 1: 77,507,196 I59F probably damaging Het
Filip1l A G 16: 57,569,711 K221E probably damaging Het
Flnc A G 6: 29,456,382 E2193G possibly damaging Het
Galnt10 C G 11: 57,783,723 P513A probably damaging Het
Gm5624 A G 14: 44,560,733 Y139H Het
Golgb1 A C 16: 36,915,424 I1719L probably benign Het
Hsf1 T C 15: 76,498,193 S255P probably benign Het
Ighv2-2 T C 12: 113,588,294 D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 Q10* probably null Het
Kcnh2 C T 5: 24,333,036 V110M probably benign Het
Magi3 A C 3: 104,016,689 L1112W probably damaging Het
Malrd1 T A 2: 16,128,068 D1933E unknown Het
Mki67 G A 7: 135,699,724 R1194* probably null Het
Nap1l1 T C 10: 111,492,908 Y233H probably damaging Het
Napsa A G 7: 44,585,334 I298V probably benign Het
Nkx6-1 A T 5: 101,663,599 S212R probably damaging Het
Nlrc4 A T 17: 74,445,615 I591N probably damaging Het
Olfr1468-ps1 T C 19: 13,375,067 I35T possibly damaging Het
Orc2 T C 1: 58,467,668 D503G possibly damaging Het
Osbp T A 19: 11,978,248 S343T probably benign Het
Pcdha6 T G 18: 36,969,426 D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Scrn2 T A 11: 97,030,929 L75Q probably damaging Het
Scube3 G A 17: 28,171,226 V955I probably benign Het
Slc1a1 T C 19: 28,911,761 V478A probably benign Het
Slc4a4 A G 5: 89,058,278 probably null Het
Srrm2 T C 17: 23,808,110 L96P unknown Het
Strn A T 17: 78,670,423 L175Q Het
Other mutations in Ppdpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ppdpf APN 2 181187894 splice site probably benign
IGL03238:Ppdpf APN 2 181187880 missense probably benign
IGL03240:Ppdpf APN 2 181187880 missense probably benign
IGL03384:Ppdpf APN 2 181187880 missense probably benign
R3917:Ppdpf UTSW 2 181187728 missense probably benign 0.19
R6148:Ppdpf UTSW 2 181187848 missense probably benign 0.01
R7134:Ppdpf UTSW 2 181187730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAACCTGGCACTGTCAG -3'
(R):5'- GAACGGGAGTGTGGATTTCC -3'

Sequencing Primer
(F):5'- TGAAGCATGGCAGCCATC -3'
(R):5'- TTTCCCGAAAAAGAAGCTGGC -3'
Posted On2020-09-15