Incidental Mutation 'R7950:Magi3'
ID 649496
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms 4732496O19Rik, 6530407C02Rik
MMRRC Submission 045995-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.435) question?
Stock # R7950 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 103920575-104127690 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 103924005 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 1112 (L1112W)
Ref Sequence ENSEMBL: ENSMUSP00000067932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303] [ENSMUST00000145727]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000064371
AA Change: L1112W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: L1112W

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121198
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122303
AA Change: L1112W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: L1112W

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145727
SMART Domains Protein: ENSMUSP00000114722
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,762,048 (GRCm39) V1248M probably damaging Het
Alb T C 5: 90,620,323 (GRCm39) S478P probably damaging Het
Arhgap17 A G 7: 122,886,039 (GRCm39) S698P probably benign Het
Arhgef5 A G 6: 43,250,859 (GRCm39) T537A possibly damaging Het
Arl6 A T 16: 59,439,094 (GRCm39) probably null Het
Atp13a4 A T 16: 29,268,735 (GRCm39) W540R Het
Birc6 A T 17: 74,900,095 (GRCm39) D1091V probably damaging Het
Bnc1 A G 7: 81,623,250 (GRCm39) V659A probably benign Het
C130074G19Rik T C 1: 184,606,571 (GRCm39) probably null Het
C1ql4 T A 15: 98,982,693 (GRCm39) H220L probably benign Het
Cacna1s A G 1: 136,028,363 (GRCm39) N1147S probably benign Het
Cc2d2a T C 5: 43,852,638 (GRCm39) probably null Het
Ccl1 T A 11: 82,070,519 (GRCm39) I18L probably benign Het
Cfap410 C T 10: 77,815,601 (GRCm39) T31I probably damaging Het
Ecel1 A T 1: 87,075,991 (GRCm39) Y729N probably damaging Het
Epha4 T A 1: 77,483,833 (GRCm39) I59F probably damaging Het
Filip1l A G 16: 57,390,074 (GRCm39) K221E probably damaging Het
Flnc A G 6: 29,456,381 (GRCm39) E2193G possibly damaging Het
Galnt10 C G 11: 57,674,549 (GRCm39) P513A probably damaging Het
Gm5624 A G 14: 44,798,190 (GRCm39) Y139H Het
Golgb1 A C 16: 36,735,786 (GRCm39) I1719L probably benign Het
Hsf1 T C 15: 76,382,393 (GRCm39) S255P probably benign Het
Ighv2-2 T C 12: 113,551,914 (GRCm39) D108G probably damaging Het
Iho1 T C 9: 108,282,870 (GRCm39) T273A probably benign Het
Kbtbd3 C T 9: 4,316,878 (GRCm39) Q10* probably null Het
Kcnh2 C T 5: 24,538,034 (GRCm39) V110M probably benign Het
Malrd1 T A 2: 16,132,879 (GRCm39) D1933E unknown Het
Mki67 G A 7: 135,301,453 (GRCm39) R1194* probably null Het
Nap1l1 T C 10: 111,328,769 (GRCm39) Y233H probably damaging Het
Napsa A G 7: 44,234,758 (GRCm39) I298V probably benign Het
Nkx6-1 A T 5: 101,811,465 (GRCm39) S212R probably damaging Het
Nlrc4 A T 17: 74,752,610 (GRCm39) I591N probably damaging Het
Or5b114-ps1 T C 19: 13,352,431 (GRCm39) I35T possibly damaging Het
Orc2 T C 1: 58,506,827 (GRCm39) D503G possibly damaging Het
Osbp T A 19: 11,955,612 (GRCm39) S343T probably benign Het
Pcdha6 T G 18: 37,102,479 (GRCm39) D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,101,876 (GRCm39) probably benign Het
Ppdpf A G 2: 180,829,650 (GRCm39) Y35C probably benign Het
Scrn2 T A 11: 96,921,755 (GRCm39) L75Q probably damaging Het
Scube3 G A 17: 28,390,200 (GRCm39) V955I probably benign Het
Slc1a1 T C 19: 28,889,161 (GRCm39) V478A probably benign Het
Slc4a4 A G 5: 89,206,137 (GRCm39) probably null Het
Srrm2 T C 17: 24,027,084 (GRCm39) L96P unknown Het
Strn A T 17: 78,977,852 (GRCm39) L175Q Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 103,922,294 (GRCm39) missense probably damaging 1.00
IGL00933:Magi3 APN 3 103,923,163 (GRCm39) missense probably benign
IGL01151:Magi3 APN 3 103,958,690 (GRCm39) missense probably damaging 1.00
IGL01674:Magi3 APN 3 104,013,037 (GRCm39) splice site probably benign
IGL01790:Magi3 APN 3 103,992,560 (GRCm39) missense probably damaging 1.00
IGL01903:Magi3 APN 3 103,958,526 (GRCm39) missense possibly damaging 0.87
IGL01939:Magi3 APN 3 103,961,778 (GRCm39) missense probably damaging 0.99
IGL02142:Magi3 APN 3 103,923,219 (GRCm39) missense probably benign 0.32
IGL02183:Magi3 APN 3 103,992,663 (GRCm39) missense probably benign 0.01
IGL02887:Magi3 APN 3 104,002,473 (GRCm39) missense probably damaging 1.00
IGL03071:Magi3 APN 3 103,923,202 (GRCm39) missense possibly damaging 0.51
IGL03085:Magi3 APN 3 103,922,655 (GRCm39) missense possibly damaging 0.88
IGL03192:Magi3 APN 3 103,950,562 (GRCm39) missense probably damaging 1.00
IGL03204:Magi3 APN 3 104,013,151 (GRCm39) missense probably damaging 1.00
IGL03227:Magi3 APN 3 103,958,435 (GRCm39) missense probably benign
IGL03388:Magi3 APN 3 103,923,157 (GRCm39) missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 103,961,668 (GRCm39) missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 103,922,842 (GRCm39) missense probably benign 0.05
R0092:Magi3 UTSW 3 103,958,280 (GRCm39) nonsense probably null
R0514:Magi3 UTSW 3 103,922,338 (GRCm39) missense probably damaging 1.00
R0569:Magi3 UTSW 3 103,923,358 (GRCm39) missense probably benign 0.43
R0608:Magi3 UTSW 3 103,924,873 (GRCm39) missense probably damaging 1.00
R0920:Magi3 UTSW 3 103,941,507 (GRCm39) splice site probably null
R1173:Magi3 UTSW 3 103,968,946 (GRCm39) critical splice donor site probably null
R1256:Magi3 UTSW 3 103,935,126 (GRCm39) missense probably benign 0.08
R1391:Magi3 UTSW 3 103,922,374 (GRCm39) nonsense probably null
R1559:Magi3 UTSW 3 103,954,169 (GRCm39) splice site probably benign
R1568:Magi3 UTSW 3 103,996,843 (GRCm39) missense probably benign 0.02
R1631:Magi3 UTSW 3 103,958,493 (GRCm39) missense probably benign 0.05
R1747:Magi3 UTSW 3 103,941,489 (GRCm39) missense possibly damaging 0.82
R1930:Magi3 UTSW 3 103,996,920 (GRCm39) missense probably damaging 1.00
R1964:Magi3 UTSW 3 103,927,718 (GRCm39) missense probably damaging 0.99
R2151:Magi3 UTSW 3 103,992,554 (GRCm39) missense probably damaging 1.00
R2151:Magi3 UTSW 3 103,954,198 (GRCm39) missense probably damaging 1.00
R2266:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2267:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2268:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2519:Magi3 UTSW 3 103,923,081 (GRCm39) missense probably benign 0.00
R3104:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3105:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3619:Magi3 UTSW 3 103,961,721 (GRCm39) missense probably damaging 1.00
R4158:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4160:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4284:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4285:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4397:Magi3 UTSW 3 104,127,030 (GRCm39) missense probably damaging 1.00
R4512:Magi3 UTSW 3 103,996,871 (GRCm39) missense probably damaging 0.99
R4676:Magi3 UTSW 3 103,923,141 (GRCm39) missense probably benign
R4758:Magi3 UTSW 3 103,922,637 (GRCm39) missense probably benign 0.01
R4940:Magi3 UTSW 3 103,958,708 (GRCm39) missense probably damaging 1.00
R5039:Magi3 UTSW 3 104,013,107 (GRCm39) missense probably damaging 1.00
R5160:Magi3 UTSW 3 103,935,224 (GRCm39) missense possibly damaging 0.46
R5422:Magi3 UTSW 3 103,958,684 (GRCm39) missense probably damaging 1.00
R5509:Magi3 UTSW 3 103,922,818 (GRCm39) missense probably benign 0.00
R5839:Magi3 UTSW 3 104,127,047 (GRCm39) missense probably damaging 1.00
R5924:Magi3 UTSW 3 103,961,854 (GRCm39) splice site probably null
R6018:Magi3 UTSW 3 104,013,128 (GRCm39) missense probably damaging 1.00
R6189:Magi3 UTSW 3 103,958,181 (GRCm39) missense probably damaging 1.00
R6235:Magi3 UTSW 3 103,923,384 (GRCm39) missense probably damaging 0.99
R6244:Magi3 UTSW 3 103,923,013 (GRCm39) missense probably benign 0.16
R6258:Magi3 UTSW 3 103,996,912 (GRCm39) missense probably damaging 1.00
R6358:Magi3 UTSW 3 103,958,268 (GRCm39) missense probably damaging 1.00
R6534:Magi3 UTSW 3 103,992,536 (GRCm39) missense possibly damaging 0.75
R6806:Magi3 UTSW 3 103,954,285 (GRCm39) missense possibly damaging 0.94
R6816:Magi3 UTSW 3 103,997,227 (GRCm39) splice site probably null
R6897:Magi3 UTSW 3 103,996,873 (GRCm39) missense probably damaging 1.00
R7011:Magi3 UTSW 3 104,013,070 (GRCm39) missense probably damaging 1.00
R7039:Magi3 UTSW 3 103,958,699 (GRCm39) missense probably damaging 1.00
R7196:Magi3 UTSW 3 103,956,484 (GRCm39) missense probably benign 0.01
R7237:Magi3 UTSW 3 103,935,227 (GRCm39) missense probably damaging 1.00
R7285:Magi3 UTSW 3 103,941,430 (GRCm39) missense probably benign 0.00
R7709:Magi3 UTSW 3 103,941,354 (GRCm39) missense probably damaging 1.00
R7724:Magi3 UTSW 3 103,923,243 (GRCm39) missense probably benign 0.04
R7797:Magi3 UTSW 3 103,958,618 (GRCm39) missense probably damaging 1.00
R8140:Magi3 UTSW 3 103,941,402 (GRCm39) missense probably damaging 1.00
R8204:Magi3 UTSW 3 103,958,502 (GRCm39) missense probably benign
R8229:Magi3 UTSW 3 103,923,018 (GRCm39) missense probably benign 0.00
R8229:Magi3 UTSW 3 103,923,017 (GRCm39) missense possibly damaging 0.79
R8260:Magi3 UTSW 3 103,922,625 (GRCm39) missense probably benign 0.01
R8348:Magi3 UTSW 3 103,958,531 (GRCm39) missense probably damaging 1.00
R8368:Magi3 UTSW 3 104,002,379 (GRCm39) critical splice donor site probably null
R8543:Magi3 UTSW 3 104,126,984 (GRCm39) missense probably damaging 0.98
R8762:Magi3 UTSW 3 103,958,169 (GRCm39) missense probably damaging 1.00
R8826:Magi3 UTSW 3 103,992,662 (GRCm39) missense probably benign 0.00
R8847:Magi3 UTSW 3 103,922,334 (GRCm39) missense probably benign 0.09
R8892:Magi3 UTSW 3 103,958,141 (GRCm39) missense probably damaging 1.00
R8939:Magi3 UTSW 3 103,996,748 (GRCm39) intron probably benign
R9090:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9187:Magi3 UTSW 3 103,923,073 (GRCm39) missense possibly damaging 0.76
R9271:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9433:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9439:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9557:Magi3 UTSW 3 103,924,933 (GRCm39) missense probably damaging 1.00
R9557:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9697:Magi3 UTSW 3 103,956,458 (GRCm39) critical splice donor site probably null
R9796:Magi3 UTSW 3 103,928,291 (GRCm39) missense probably benign
X0026:Magi3 UTSW 3 103,927,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTGTCAAATTTAATGTCAAAGGG -3'
(R):5'- CACCATGCGCATTTGTGTC -3'

Sequencing Primer
(F):5'- TGTCAAAGGGAGATTGAAAAAGTGC -3'
(R):5'- CAACTCCCCATTAGAGCTTTTG -3'
Posted On 2020-09-15