Incidental Mutation 'R7950:Alb'
List |< first << previous [record 3 of 45] next >> last >|
ID649499
Institutional Source Beutler Lab
Gene Symbol Alb
Ensembl Gene ENSMUSG00000029368
Gene Namealbumin
SynonymsAlb1, Alb-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7950 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location90460897-90476602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90472464 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 478 (S478P)
Ref Sequence ENSEMBL: ENSMUSP00000031314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031314]
Predicted Effect probably damaging
Transcript: ENSMUST00000031314
AA Change: S478P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031314
Gene: ENSMUSG00000029368
AA Change: S478P

DomainStartEndE-ValueType
ALBUMIN 20 205 1.54e-84 SMART
ALBUMIN 212 397 3.43e-82 SMART
ALBUMIN 404 595 1.51e-83 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes albumin, an abundant plasma protein essential for maintaining oncotic pressure that functions as a carrier protein for various molecules such as steriods and fatty acids in blood. This gene is primarily expressed in liver where the encoded protein undergoes proteolytic processing before secretion into the plasma. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a TALEN-mediated deletion exhibit analbuminemia but appear healthy and grossly normal and breed normally. Mice heterozygotes for an ENU-induced point mutation have significantly reduced plasma albumin and calcium levels and significantly elevated alkaline phosphatase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,979,767 T31I probably damaging Het
Adgrf5 G A 17: 43,451,157 V1248M probably damaging Het
Arhgap17 A G 7: 123,286,816 S698P probably benign Het
Arhgef5 A G 6: 43,273,925 T537A possibly damaging Het
Arl6 A T 16: 59,618,731 probably null Het
Atp13a4 A T 16: 29,449,917 W540R Het
Birc6 A T 17: 74,593,100 D1091V probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
C130074G19Rik T C 1: 184,874,374 probably null Het
C1ql4 T A 15: 99,084,812 H220L probably benign Het
Cacna1s A G 1: 136,100,625 N1147S probably benign Het
Cc2d2a T C 5: 43,695,296 probably null Het
Ccdc36 T C 9: 108,405,671 T273A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Ecel1 A T 1: 87,148,269 Y729N probably damaging Het
Epha4 T A 1: 77,507,196 I59F probably damaging Het
Filip1l A G 16: 57,569,711 K221E probably damaging Het
Flnc A G 6: 29,456,382 E2193G possibly damaging Het
Galnt10 C G 11: 57,783,723 P513A probably damaging Het
Gm5624 A G 14: 44,560,733 Y139H Het
Golgb1 A C 16: 36,915,424 I1719L probably benign Het
Hsf1 T C 15: 76,498,193 S255P probably benign Het
Ighv2-2 T C 12: 113,588,294 D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 Q10* probably null Het
Kcnh2 C T 5: 24,333,036 V110M probably benign Het
Magi3 A C 3: 104,016,689 L1112W probably damaging Het
Malrd1 T A 2: 16,128,068 D1933E unknown Het
Mki67 G A 7: 135,699,724 R1194* probably null Het
Nap1l1 T C 10: 111,492,908 Y233H probably damaging Het
Napsa A G 7: 44,585,334 I298V probably benign Het
Nkx6-1 A T 5: 101,663,599 S212R probably damaging Het
Nlrc4 A T 17: 74,445,615 I591N probably damaging Het
Olfr1468-ps1 T C 19: 13,375,067 I35T possibly damaging Het
Orc2 T C 1: 58,467,668 D503G possibly damaging Het
Osbp T A 19: 11,978,248 S343T probably benign Het
Pcdha6 T G 18: 36,969,426 D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Ppdpf A G 2: 181,187,857 Y35C probably benign Het
Scrn2 T A 11: 97,030,929 L75Q probably damaging Het
Scube3 G A 17: 28,171,226 V955I probably benign Het
Slc1a1 T C 19: 28,911,761 V478A probably benign Het
Slc4a4 A G 5: 89,058,278 probably null Het
Srrm2 T C 17: 23,808,110 L96P unknown Het
Strn A T 17: 78,670,423 L175Q Het
Other mutations in Alb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Alb APN 5 90472073 missense probably benign 0.00
IGL01508:Alb APN 5 90470838 missense probably benign 0.19
IGL01722:Alb APN 5 90470839 critical splice donor site probably null
IGL02103:Alb APN 5 90464131 missense probably benign 0.00
IGL02379:Alb APN 5 90465879 missense probably benign 0.00
IGL02531:Alb APN 5 90467448 missense probably damaging 1.00
IGL02704:Alb APN 5 90468509 missense possibly damaging 0.82
IGL02828:Alb APN 5 90467388 missense probably benign 0.17
IGL03248:Alb APN 5 90461714 splice site probably benign
Flavius UTSW 5 90467355 missense probably damaging 1.00
R0714:Alb UTSW 5 90462806 missense possibly damaging 0.81
R1418:Alb UTSW 5 90464202 splice site probably benign
R1708:Alb UTSW 5 90464051 missense possibly damaging 0.73
R2092:Alb UTSW 5 90463983 frame shift probably null
R4473:Alb UTSW 5 90464053 missense probably damaging 1.00
R4670:Alb UTSW 5 90462806 missense probably benign 0.00
R4758:Alb UTSW 5 90468593 missense probably benign 0.00
R5583:Alb UTSW 5 90468593 missense probably benign 0.00
R6384:Alb UTSW 5 90472640 missense possibly damaging 0.67
R7268:Alb UTSW 5 90462716 missense probably benign 0.15
R7295:Alb UTSW 5 90462834 critical splice donor site probably null
R7320:Alb UTSW 5 90464987 critical splice donor site probably null
R7337:Alb UTSW 5 90474593 missense probably damaging 1.00
R7505:Alb UTSW 5 90469509 missense probably damaging 1.00
R7575:Alb UTSW 5 90465929 missense probably damaging 1.00
R7651:Alb UTSW 5 90467355 missense probably damaging 1.00
R7652:Alb UTSW 5 90467355 missense probably damaging 1.00
R7654:Alb UTSW 5 90467355 missense probably damaging 1.00
R7669:Alb UTSW 5 90463991 missense possibly damaging 0.93
R7870:Alb UTSW 5 90472629 missense possibly damaging 0.96
R7879:Alb UTSW 5 90472648 missense probably benign 0.21
R7978:Alb UTSW 5 90472073 missense possibly damaging 0.77
R8077:Alb UTSW 5 90467355 missense probably damaging 1.00
R8078:Alb UTSW 5 90467355 missense probably damaging 1.00
R8316:Alb UTSW 5 90468590 missense probably benign 0.20
R8480:Alb UTSW 5 90462771 missense probably damaging 0.99
R8531:Alb UTSW 5 90464014 missense probably benign 0.00
Z1177:Alb UTSW 5 90468512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTTTCAGGAGCAAGGGG -3'
(R):5'- TCCTTCTCTGGAAGTGTGCAG -3'

Sequencing Primer
(F):5'- GGGGGTCCTAATACATGCATATG -3'
(R):5'- TCTGGAAGTGTGCAGATATCAG -3'
Posted On2020-09-15