Incidental Mutation 'R7950:Arhgap17'
ID649508
Institutional Source Beutler Lab
Gene Symbol Arhgap17
Ensembl Gene ENSMUSG00000030766
Gene NameRho GTPase activating protein 17
SynonymsNadrin2, Nadrin, WBP15, 5730403H17Rik, Rich1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7950 (G1)
Quality Score157.009
Status Validated
Chromosome7
Chromosomal Location123279218-123369915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123286816 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 698 (S698P)
Ref Sequence ENSEMBL: ENSMUSP00000102050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098060] [ENSMUST00000106442] [ENSMUST00000167309] [ENSMUST00000205262] [ENSMUST00000206117] [ENSMUST00000207010]
Predicted Effect unknown
Transcript: ENSMUST00000098060
AA Change: S620P
SMART Domains Protein: ENSMUSP00000095668
Gene: ENSMUSG00000030766
AA Change: S620P

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 554 595 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 644 664 N/A INTRINSIC
low complexity region 683 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106442
AA Change: S698P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102050
Gene: ENSMUSG00000030766
AA Change: S698P

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000167309
AA Change: S698P
SMART Domains Protein: ENSMUSP00000128447
Gene: ENSMUSG00000030766
AA Change: S698P

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000205262
AA Change: S620P
Predicted Effect probably benign
Transcript: ENSMUST00000206117
Predicted Effect unknown
Transcript: ENSMUST00000207010
AA Change: S620P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICH1 is a GTPase-activating protein (GAP). GAPs stimulate the intrinsic GTP hydrolysis of small G proteins, such as RHOA (MIM 165390), RAC1 (MIM 602048), and CDC42 (MIM 116952).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,979,767 T31I probably damaging Het
Adgrf5 G A 17: 43,451,157 V1248M probably damaging Het
Alb T C 5: 90,472,464 S478P probably damaging Het
Arhgef5 A G 6: 43,273,925 T537A possibly damaging Het
Arl6 A T 16: 59,618,731 probably null Het
Atp13a4 A T 16: 29,449,917 W540R Het
Birc6 A T 17: 74,593,100 D1091V probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
C130074G19Rik T C 1: 184,874,374 probably null Het
C1ql4 T A 15: 99,084,812 H220L probably benign Het
Cacna1s A G 1: 136,100,625 N1147S probably benign Het
Cc2d2a T C 5: 43,695,296 probably null Het
Ccdc36 T C 9: 108,405,671 T273A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Ecel1 A T 1: 87,148,269 Y729N probably damaging Het
Epha4 T A 1: 77,507,196 I59F probably damaging Het
Filip1l A G 16: 57,569,711 K221E probably damaging Het
Flnc A G 6: 29,456,382 E2193G possibly damaging Het
Galnt10 C G 11: 57,783,723 P513A probably damaging Het
Gm5624 A G 14: 44,560,733 Y139H Het
Golgb1 A C 16: 36,915,424 I1719L probably benign Het
Hsf1 T C 15: 76,498,193 S255P probably benign Het
Ighv2-2 T C 12: 113,588,294 D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 Q10* probably null Het
Kcnh2 C T 5: 24,333,036 V110M probably benign Het
Magi3 A C 3: 104,016,689 L1112W probably damaging Het
Malrd1 T A 2: 16,128,068 D1933E unknown Het
Mki67 G A 7: 135,699,724 R1194* probably null Het
Nap1l1 T C 10: 111,492,908 Y233H probably damaging Het
Napsa A G 7: 44,585,334 I298V probably benign Het
Nkx6-1 A T 5: 101,663,599 S212R probably damaging Het
Nlrc4 A T 17: 74,445,615 I591N probably damaging Het
Olfr1468-ps1 T C 19: 13,375,067 I35T possibly damaging Het
Orc2 T C 1: 58,467,668 D503G possibly damaging Het
Osbp T A 19: 11,978,248 S343T probably benign Het
Pcdha6 T G 18: 36,969,426 D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Ppdpf A G 2: 181,187,857 Y35C probably benign Het
Scrn2 T A 11: 97,030,929 L75Q probably damaging Het
Scube3 G A 17: 28,171,226 V955I probably benign Het
Slc1a1 T C 19: 28,911,761 V478A probably benign Het
Slc4a4 A G 5: 89,058,278 probably null Het
Srrm2 T C 17: 23,808,110 L96P unknown Het
Strn A T 17: 78,670,423 L175Q Het
Other mutations in Arhgap17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Arhgap17 APN 7 123286568 utr 3 prime probably benign
IGL02112:Arhgap17 APN 7 123318417 missense possibly damaging 0.92
IGL02117:Arhgap17 APN 7 123286773 utr 3 prime probably benign
IGL03062:Arhgap17 APN 7 123321874 splice site probably null
gensing UTSW 7 123314690 missense probably damaging 1.00
Nightshade UTSW 7 123327244 missense probably damaging 1.00
tuberose UTSW 7 123308377 missense probably damaging 1.00
yam UTSW 7 123306420 missense probably damaging 1.00
P0028:Arhgap17 UTSW 7 123286677 utr 3 prime probably benign
R0480:Arhgap17 UTSW 7 123294644 missense probably damaging 0.98
R0593:Arhgap17 UTSW 7 123286743 utr 3 prime probably benign
R0594:Arhgap17 UTSW 7 123294518 missense probably benign 0.00
R0599:Arhgap17 UTSW 7 123303790 splice site probably benign
R0751:Arhgap17 UTSW 7 123314690 missense probably damaging 1.00
R1184:Arhgap17 UTSW 7 123314690 missense probably damaging 1.00
R1791:Arhgap17 UTSW 7 123286702 missense probably benign 0.23
R2036:Arhgap17 UTSW 7 123318494 missense possibly damaging 0.92
R3428:Arhgap17 UTSW 7 123323631 missense probably damaging 1.00
R4032:Arhgap17 UTSW 7 123280066 utr 3 prime probably benign
R4119:Arhgap17 UTSW 7 123306994 missense probably damaging 1.00
R4652:Arhgap17 UTSW 7 123286618 utr 3 prime probably benign
R4687:Arhgap17 UTSW 7 123321603 missense probably damaging 1.00
R4910:Arhgap17 UTSW 7 123308377 missense probably damaging 1.00
R4960:Arhgap17 UTSW 7 123286926 utr 3 prime probably benign
R4963:Arhgap17 UTSW 7 123308360 missense possibly damaging 0.91
R5028:Arhgap17 UTSW 7 123294673 missense probably benign 0.05
R5253:Arhgap17 UTSW 7 123303748 missense probably benign 0.00
R5316:Arhgap17 UTSW 7 123296527 missense possibly damaging 0.63
R5410:Arhgap17 UTSW 7 123297493 critical splice donor site probably null
R5890:Arhgap17 UTSW 7 123286758 utr 3 prime probably benign
R6367:Arhgap17 UTSW 7 123308363 makesense probably null
R6376:Arhgap17 UTSW 7 123300504 missense probably damaging 1.00
R6513:Arhgap17 UTSW 7 123292156 missense possibly damaging 0.87
R6862:Arhgap17 UTSW 7 123321901 missense probably damaging 0.98
R6962:Arhgap17 UTSW 7 123296432 missense probably damaging 1.00
R7077:Arhgap17 UTSW 7 123280008 missense unknown
R7178:Arhgap17 UTSW 7 123285358 splice site probably null
R7205:Arhgap17 UTSW 7 123306438 missense probably damaging 1.00
R7342:Arhgap17 UTSW 7 123327244 missense probably damaging 1.00
R7524:Arhgap17 UTSW 7 123306420 missense probably damaging 1.00
R7812:Arhgap17 UTSW 7 123280067 missense unknown
R7901:Arhgap17 UTSW 7 123286568 utr 3 prime probably benign
R7952:Arhgap17 UTSW 7 123286691 missense probably benign 0.23
RF009:Arhgap17 UTSW 7 123286862 small deletion probably benign
RF015:Arhgap17 UTSW 7 123286862 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GATGTAAGGCCACCATCCAC -3'
(R):5'- TGCAGCTGTGAAGAAACCTG -3'

Sequencing Primer
(F):5'- AGGGTTCCGTGCAGCTG -3'
(R):5'- TGTGAAGAAACCTGCCCCCG -3'
Posted On2020-09-15