Incidental Mutation 'R7950:Iho1'
ID 649511
Institutional Source Beutler Lab
Gene Symbol Iho1
Ensembl Gene ENSMUSG00000047220
Gene Name interactor of HORMAD1 1
Synonyms Ccdc36, Iho1
MMRRC Submission 045995-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R7950 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108280810-108305683 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108282870 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 273 (T273A)
Ref Sequence ENSEMBL: ENSMUSP00000075898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076592] [ENSMUST00000192995]
AlphaFold Q6PDM4
Predicted Effect probably benign
Transcript: ENSMUST00000076592
AA Change: T273A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075898
Gene: ENSMUSG00000047220
AA Change: T273A

DomainStartEndE-ValueType
Pfam:DUF4700 19 572 4.7e-274 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192995
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,762,048 (GRCm39) V1248M probably damaging Het
Alb T C 5: 90,620,323 (GRCm39) S478P probably damaging Het
Arhgap17 A G 7: 122,886,039 (GRCm39) S698P probably benign Het
Arhgef5 A G 6: 43,250,859 (GRCm39) T537A possibly damaging Het
Arl6 A T 16: 59,439,094 (GRCm39) probably null Het
Atp13a4 A T 16: 29,268,735 (GRCm39) W540R Het
Birc6 A T 17: 74,900,095 (GRCm39) D1091V probably damaging Het
Bnc1 A G 7: 81,623,250 (GRCm39) V659A probably benign Het
C130074G19Rik T C 1: 184,606,571 (GRCm39) probably null Het
C1ql4 T A 15: 98,982,693 (GRCm39) H220L probably benign Het
Cacna1s A G 1: 136,028,363 (GRCm39) N1147S probably benign Het
Cc2d2a T C 5: 43,852,638 (GRCm39) probably null Het
Ccl1 T A 11: 82,070,519 (GRCm39) I18L probably benign Het
Cfap410 C T 10: 77,815,601 (GRCm39) T31I probably damaging Het
Ecel1 A T 1: 87,075,991 (GRCm39) Y729N probably damaging Het
Epha4 T A 1: 77,483,833 (GRCm39) I59F probably damaging Het
Filip1l A G 16: 57,390,074 (GRCm39) K221E probably damaging Het
Flnc A G 6: 29,456,381 (GRCm39) E2193G possibly damaging Het
Galnt10 C G 11: 57,674,549 (GRCm39) P513A probably damaging Het
Gm5624 A G 14: 44,798,190 (GRCm39) Y139H Het
Golgb1 A C 16: 36,735,786 (GRCm39) I1719L probably benign Het
Hsf1 T C 15: 76,382,393 (GRCm39) S255P probably benign Het
Ighv2-2 T C 12: 113,551,914 (GRCm39) D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 (GRCm39) Q10* probably null Het
Kcnh2 C T 5: 24,538,034 (GRCm39) V110M probably benign Het
Magi3 A C 3: 103,924,005 (GRCm39) L1112W probably damaging Het
Malrd1 T A 2: 16,132,879 (GRCm39) D1933E unknown Het
Mki67 G A 7: 135,301,453 (GRCm39) R1194* probably null Het
Nap1l1 T C 10: 111,328,769 (GRCm39) Y233H probably damaging Het
Napsa A G 7: 44,234,758 (GRCm39) I298V probably benign Het
Nkx6-1 A T 5: 101,811,465 (GRCm39) S212R probably damaging Het
Nlrc4 A T 17: 74,752,610 (GRCm39) I591N probably damaging Het
Or5b114-ps1 T C 19: 13,352,431 (GRCm39) I35T possibly damaging Het
Orc2 T C 1: 58,506,827 (GRCm39) D503G possibly damaging Het
Osbp T A 19: 11,955,612 (GRCm39) S343T probably benign Het
Pcdha6 T G 18: 37,102,479 (GRCm39) D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,101,876 (GRCm39) probably benign Het
Ppdpf A G 2: 180,829,650 (GRCm39) Y35C probably benign Het
Scrn2 T A 11: 96,921,755 (GRCm39) L75Q probably damaging Het
Scube3 G A 17: 28,390,200 (GRCm39) V955I probably benign Het
Slc1a1 T C 19: 28,889,161 (GRCm39) V478A probably benign Het
Slc4a4 A G 5: 89,206,137 (GRCm39) probably null Het
Srrm2 T C 17: 24,027,084 (GRCm39) L96P unknown Het
Strn A T 17: 78,977,852 (GRCm39) L175Q Het
Other mutations in Iho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Iho1 APN 9 108,294,518 (GRCm39) splice site probably benign
IGL02138:Iho1 APN 9 108,283,820 (GRCm39) missense probably benign 0.00
IGL02305:Iho1 APN 9 108,283,031 (GRCm39) missense possibly damaging 0.82
IGL02456:Iho1 APN 9 108,283,820 (GRCm39) missense probably benign 0.00
IGL02936:Iho1 APN 9 108,289,702 (GRCm39) missense possibly damaging 0.69
IGL03150:Iho1 APN 9 108,282,155 (GRCm39) missense probably damaging 0.98
IGL03163:Iho1 APN 9 108,282,132 (GRCm39) missense probably benign 0.00
IGL03280:Iho1 APN 9 108,282,099 (GRCm39) missense possibly damaging 0.92
R0139:Iho1 UTSW 9 108,289,695 (GRCm39) missense probably damaging 1.00
R0276:Iho1 UTSW 9 108,305,639 (GRCm39) missense possibly damaging 0.84
R0744:Iho1 UTSW 9 108,282,000 (GRCm39) missense probably benign
R0836:Iho1 UTSW 9 108,282,000 (GRCm39) missense probably benign
R1792:Iho1 UTSW 9 108,282,111 (GRCm39) missense possibly damaging 0.84
R1918:Iho1 UTSW 9 108,290,184 (GRCm39) missense probably benign 0.16
R2284:Iho1 UTSW 9 108,298,672 (GRCm39) missense probably damaging 1.00
R2401:Iho1 UTSW 9 108,290,205 (GRCm39) missense possibly damaging 0.53
R4731:Iho1 UTSW 9 108,282,584 (GRCm39) missense probably benign 0.00
R4819:Iho1 UTSW 9 108,283,877 (GRCm39) missense probably benign 0.10
R4950:Iho1 UTSW 9 108,298,709 (GRCm39) missense probably damaging 1.00
R4968:Iho1 UTSW 9 108,289,713 (GRCm39) missense probably benign 0.11
R7131:Iho1 UTSW 9 108,294,619 (GRCm39) missense probably benign 0.01
R7201:Iho1 UTSW 9 108,281,974 (GRCm39) missense probably damaging 0.98
R8778:Iho1 UTSW 9 108,282,807 (GRCm39) missense probably damaging 0.97
R9316:Iho1 UTSW 9 108,298,726 (GRCm39) missense possibly damaging 0.60
R9501:Iho1 UTSW 9 108,282,500 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCCCATCTGTTGGCAATG -3'
(R):5'- TCTTTCCCAGAGACAAGCAG -3'

Sequencing Primer
(F):5'- GCAATGCAGCCTTTTGAAAAAC -3'
(R):5'- TTCCCAGAGACAAGCAGAATTTATGG -3'
Posted On 2020-09-15