Incidental Mutation 'R7950:Galnt10'
ID649514
Institutional Source Beutler Lab
Gene Symbol Galnt10
Ensembl Gene ENSMUSG00000020520
Gene Namepolypeptide N-acetylgalactosaminyltransferase 10
SynonymsGalnt9, C330012K04Rik, GalNAc-T10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7950 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location57645442-57787514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 57783723 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 513 (P513A)
Ref Sequence ENSEMBL: ENSMUSP00000065096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066987]
Predicted Effect probably damaging
Transcript: ENSMUST00000066987
AA Change: P513A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065096
Gene: ENSMUSG00000020520
AA Change: P513A

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 145 376 4.7e-8 PFAM
Pfam:Glycos_transf_2 148 333 1.9e-37 PFAM
Pfam:Glyco_tranf_2_2 148 373 3e-7 PFAM
Pfam:Glyco_transf_7C 303 376 2.3e-11 PFAM
RICIN 460 590 4.29e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GalNAc polypeptide N-acetylgalactosaminyltransferases. These enzymes catalyze the first step in the synthesis of mucin-type oligosaccharides. These proteins transfer GalNAc from UDP-GalNAc to either serine or threonine residues of polypeptide acceptors. The protein encoded by this locus may have increased catalytic activity toward glycosylated peptides compared to activity toward non-glycosylated peptides.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,979,767 T31I probably damaging Het
Adgrf5 G A 17: 43,451,157 V1248M probably damaging Het
Alb T C 5: 90,472,464 S478P probably damaging Het
Arhgap17 A G 7: 123,286,816 S698P probably benign Het
Arhgef5 A G 6: 43,273,925 T537A possibly damaging Het
Arl6 A T 16: 59,618,731 probably null Het
Atp13a4 A T 16: 29,449,917 W540R Het
Birc6 A T 17: 74,593,100 D1091V probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
C130074G19Rik T C 1: 184,874,374 probably null Het
C1ql4 T A 15: 99,084,812 H220L probably benign Het
Cacna1s A G 1: 136,100,625 N1147S probably benign Het
Cc2d2a T C 5: 43,695,296 probably null Het
Ccdc36 T C 9: 108,405,671 T273A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Ecel1 A T 1: 87,148,269 Y729N probably damaging Het
Epha4 T A 1: 77,507,196 I59F probably damaging Het
Filip1l A G 16: 57,569,711 K221E probably damaging Het
Flnc A G 6: 29,456,382 E2193G possibly damaging Het
Gm5624 A G 14: 44,560,733 Y139H Het
Golgb1 A C 16: 36,915,424 I1719L probably benign Het
Hsf1 T C 15: 76,498,193 S255P probably benign Het
Ighv2-2 T C 12: 113,588,294 D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 Q10* probably null Het
Kcnh2 C T 5: 24,333,036 V110M probably benign Het
Magi3 A C 3: 104,016,689 L1112W probably damaging Het
Malrd1 T A 2: 16,128,068 D1933E unknown Het
Mki67 G A 7: 135,699,724 R1194* probably null Het
Nap1l1 T C 10: 111,492,908 Y233H probably damaging Het
Napsa A G 7: 44,585,334 I298V probably benign Het
Nkx6-1 A T 5: 101,663,599 S212R probably damaging Het
Nlrc4 A T 17: 74,445,615 I591N probably damaging Het
Olfr1468-ps1 T C 19: 13,375,067 I35T possibly damaging Het
Orc2 T C 1: 58,467,668 D503G possibly damaging Het
Osbp T A 19: 11,978,248 S343T probably benign Het
Pcdha6 T G 18: 36,969,426 D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Ppdpf A G 2: 181,187,857 Y35C probably benign Het
Scrn2 T A 11: 97,030,929 L75Q probably damaging Het
Scube3 G A 17: 28,171,226 V955I probably benign Het
Slc1a1 T C 19: 28,911,761 V478A probably benign Het
Slc4a4 A G 5: 89,058,278 probably null Het
Srrm2 T C 17: 23,808,110 L96P unknown Het
Strn A T 17: 78,670,423 L175Q Het
Other mutations in Galnt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Galnt10 APN 11 57725583 missense probably damaging 1.00
IGL02085:Galnt10 APN 11 57782278 missense probably benign
IGL02154:Galnt10 APN 11 57784705 missense probably damaging 1.00
IGL02418:Galnt10 APN 11 57781168 missense probably benign 0.00
IGL02810:Galnt10 APN 11 57725586 missense probably damaging 0.99
IGL03070:Galnt10 APN 11 57725582 missense probably damaging 1.00
IGL03191:Galnt10 APN 11 57771500 missense probably damaging 1.00
R0257:Galnt10 UTSW 11 57781078 missense probably damaging 1.00
R0483:Galnt10 UTSW 11 57781222 missense probably damaging 1.00
R0681:Galnt10 UTSW 11 57769540 missense probably damaging 1.00
R1102:Galnt10 UTSW 11 57781045 splice site probably benign
R1436:Galnt10 UTSW 11 57771469 missense probably damaging 1.00
R1959:Galnt10 UTSW 11 57765617 missense probably damaging 1.00
R3424:Galnt10 UTSW 11 57645713 missense probably benign
R4445:Galnt10 UTSW 11 57783691 missense probably damaging 0.98
R5183:Galnt10 UTSW 11 57769588 missense probably damaging 1.00
R5369:Galnt10 UTSW 11 57765747 critical splice donor site probably null
R5838:Galnt10 UTSW 11 57781056 missense probably damaging 0.99
R6045:Galnt10 UTSW 11 57783793 missense probably damaging 1.00
R6148:Galnt10 UTSW 11 57784648 missense probably damaging 1.00
R6442:Galnt10 UTSW 11 57765622 missense probably benign 0.03
R6851:Galnt10 UTSW 11 57765632 missense probably damaging 1.00
R6873:Galnt10 UTSW 11 57781219 missense probably damaging 1.00
R7013:Galnt10 UTSW 11 57765584 missense probably benign 0.22
R7696:Galnt10 UTSW 11 57769538 missense probably damaging 1.00
R8208:Galnt10 UTSW 11 57645572 missense possibly damaging 0.85
R8264:Galnt10 UTSW 11 57782206 missense probably benign 0.01
Z1088:Galnt10 UTSW 11 57721331 missense possibly damaging 0.93
Z1177:Galnt10 UTSW 11 57737000 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CTAACAGTACGGTGCCATCTC -3'
(R):5'- ATGCATGAGTCTGGGTTCC -3'

Sequencing Primer
(F):5'- TAACAGTACGGTGCCATCTCAAGTG -3'
(R):5'- CATGAGTCTGGGTTCCTGTCC -3'
Posted On2020-09-15