Incidental Mutation 'R7950:Ccl1'
List |< first << previous [record 15 of 45] next >> last >|
ID649515
Institutional Source Beutler Lab
Gene Symbol Ccl1
Ensembl Gene ENSMUSG00000020702
Gene Namechemokine (C-C motif) ligand 1
SynonymsScya1, CCR8 ligand, Tca-3, I-309
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7950 (G1)
Quality Score185.009
Status Validated
Chromosome11
Chromosomal Location82176657-82305690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82179693 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 18 (I18L)
Ref Sequence ENSEMBL: ENSMUSP00000103824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021043] [ENSMUST00000108189]
Predicted Effect probably benign
Transcript: ENSMUST00000021043
AA Change: I18L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021043
Gene: ENSMUSG00000020702
AA Change: I18L

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SCY 30 80 1.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108189
AA Change: I18L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103824
Gene: ENSMUSG00000020702
AA Change: I18L

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SCY 30 89 3.23e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138333
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, is secreted by activated T cells and displays chemotactic activity for monocytes but not for neutrophils. It binds to the chemokine (C-C motif) receptor 8. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted null allele are refractory to the anti-inflammatory response of the statin drug lovastatin and fail to exhibit an increase in regulatory T cell recruitment to sites of inflammation in a model of delayed-type hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,979,767 T31I probably damaging Het
Adgrf5 G A 17: 43,451,157 V1248M probably damaging Het
Alb T C 5: 90,472,464 S478P probably damaging Het
Arhgap17 A G 7: 123,286,816 S698P probably benign Het
Arhgef5 A G 6: 43,273,925 T537A possibly damaging Het
Arl6 A T 16: 59,618,731 probably null Het
Atp13a4 A T 16: 29,449,917 W540R Het
Birc6 A T 17: 74,593,100 D1091V probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
C130074G19Rik T C 1: 184,874,374 probably null Het
C1ql4 T A 15: 99,084,812 H220L probably benign Het
Cacna1s A G 1: 136,100,625 N1147S probably benign Het
Cc2d2a T C 5: 43,695,296 probably null Het
Ccdc36 T C 9: 108,405,671 T273A probably benign Het
Ecel1 A T 1: 87,148,269 Y729N probably damaging Het
Epha4 T A 1: 77,507,196 I59F probably damaging Het
Filip1l A G 16: 57,569,711 K221E probably damaging Het
Flnc A G 6: 29,456,382 E2193G possibly damaging Het
Galnt10 C G 11: 57,783,723 P513A probably damaging Het
Gm5624 A G 14: 44,560,733 Y139H Het
Golgb1 A C 16: 36,915,424 I1719L probably benign Het
Hsf1 T C 15: 76,498,193 S255P probably benign Het
Ighv2-2 T C 12: 113,588,294 D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 Q10* probably null Het
Kcnh2 C T 5: 24,333,036 V110M probably benign Het
Magi3 A C 3: 104,016,689 L1112W probably damaging Het
Malrd1 T A 2: 16,128,068 D1933E unknown Het
Mki67 G A 7: 135,699,724 R1194* probably null Het
Nap1l1 T C 10: 111,492,908 Y233H probably damaging Het
Napsa A G 7: 44,585,334 I298V probably benign Het
Nkx6-1 A T 5: 101,663,599 S212R probably damaging Het
Nlrc4 A T 17: 74,445,615 I591N probably damaging Het
Olfr1468-ps1 T C 19: 13,375,067 I35T possibly damaging Het
Orc2 T C 1: 58,467,668 D503G possibly damaging Het
Osbp T A 19: 11,978,248 S343T probably benign Het
Pcdha6 T G 18: 36,969,426 D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Ppdpf A G 2: 181,187,857 Y35C probably benign Het
Scrn2 T A 11: 97,030,929 L75Q probably damaging Het
Scube3 G A 17: 28,171,226 V955I probably benign Het
Slc1a1 T C 19: 28,911,761 V478A probably benign Het
Slc4a4 A G 5: 89,058,278 probably null Het
Srrm2 T C 17: 23,808,110 L96P unknown Het
Strn A T 17: 78,670,423 L175Q Het
Other mutations in Ccl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Ccl1 APN 11 82178088 missense possibly damaging 0.85
IGL01805:Ccl1 APN 11 82178132 missense possibly damaging 0.88
IGL03118:Ccl1 APN 11 82178070 missense probably damaging 1.00
R0017:Ccl1 UTSW 11 82178017 critical splice donor site probably null
R4044:Ccl1 UTSW 11 82179693 missense probably benign 0.00
R5743:Ccl1 UTSW 11 82176886 missense possibly damaging 0.90
R6483:Ccl1 UTSW 11 82178034 missense possibly damaging 0.60
R6878:Ccl1 UTSW 11 82179693 missense probably benign 0.36
R6938:Ccl1 UTSW 11 82176858 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTAGATGTGTGCTCCCAGTC -3'
(R):5'- TCTCCATGGTCTGGGAAAGC -3'

Sequencing Primer
(F):5'- AGATGTGTGCTCCCAGTCCATAAC -3'
(R):5'- AAAGCACCCCGGGCCTTC -3'
Posted On2020-09-15