Mutagenetix > Incidental Mutations

Incidental Mutation 'R7950:Strn'

List |< first << previous [record 45 of 45]

649529

Institutional Source

Beutler Lab

Gene Symbol

Strn

Ensembl Gene

ENSMUSG00000024077

Gene Name

striatin, calmodulin binding protein

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.679) question?

Stock #

R7950 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78649913-78737196 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 78670423 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 175 (L175Q)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024881] [ENSMUST00000145910]

Predicted Effect

probably benign
Transcript: ENSMUST00000024881

SMART Domains

Protein: ENSMUSP00000024881
Gene: ENSMUSG00000024077

Domain	Start	End	E-Value	Type
low complexity region	85	101	N/A	INTRINSIC
low complexity region	178	195	N/A	INTRINSIC
low complexity region	223	231	N/A	INTRINSIC
low complexity region	259	276	N/A	INTRINSIC
WD40	299	338	6.04e-8	SMART
WD40	352	391	2.42e-7	SMART
WD40	405	444	1.21e-7	SMART
WD40	493	539	1.28e1	SMART
WD40	542	581	4.4e-10	SMART
WD40	584	627	2.48e-4	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000117663
Gene: ENSMUSG00000024077
AA Change: L175Q

Domain	Start	End	E-Value	Type
low complexity region	60	76	N/A	INTRINSIC
low complexity region	153	171	N/A	INTRINSIC
low complexity region	227	235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145910

SMART Domains

Protein: ENSMUSP00000120830
Gene: ENSMUSG00000024077

Domain	Start	End	E-Value	Type
low complexity region	17	45	N/A	INTRINSIC
Pfam:Striatin	48	177	4.2e-50	PFAM
low complexity region	238	254	N/A	INTRINSIC
low complexity region	331	348	N/A	INTRINSIC
low complexity region	376	384	N/A	INTRINSIC
low complexity region	412	429	N/A	INTRINSIC
WD40	452	491	6.04e-8	SMART
WD40	505	544	2.42e-7	SMART
WD40	558	597	1.21e-7	SMART
WD40	646	692	1.28e1	SMART
WD40	695	734	4.4e-10	SMART
WD40	737	780	2.48e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

MGI Phenotype

PHENOTYPE: Mice heterozygous for a knock-out allele exhibit increased blood pressure and circulating aldosterone when fed a liberal salt diet. No mice could be generated that were homozygous for the allele. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,979,767	T31I	probably damaging	Het
Adgrf5	G	A	17: 43,451,157	V1248M	probably damaging	Het
Alb	T	C	5: 90,472,464	S478P	probably damaging	Het
Arhgap17	A	G	7: 123,286,816	S698P	probably benign	Het
Arhgef5	A	G	6: 43,273,925	T537A	possibly damaging	Het
Arl6	A	T	16: 59,618,731		probably null	Het
Atp13a4	A	T	16: 29,449,917	W540R		Het
Birc6	A	T	17: 74,593,100	D1091V	probably damaging	Het
Bnc1	A	G	7: 81,973,502	V659A	probably benign	Het
C130074G19Rik	T	C	1: 184,874,374		probably null	Het
C1ql4	T	A	15: 99,084,812	H220L	probably benign	Het
Cacna1s	A	G	1: 136,100,625	N1147S	probably benign	Het
Cc2d2a	T	C	5: 43,695,296		probably null	Het
Ccdc36	T	C	9: 108,405,671	T273A	probably benign	Het
Ccl1	T	A	11: 82,179,693	I18L	probably benign	Het
Ecel1	A	T	1: 87,148,269	Y729N	probably damaging	Het
Epha4	T	A	1: 77,507,196	I59F	probably damaging	Het
Filip1l	A	G	16: 57,569,711	K221E	probably damaging	Het
Flnc	A	G	6: 29,456,382	E2193G	possibly damaging	Het
Galnt10	C	G	11: 57,783,723	P513A	probably damaging	Het
Gm5624	A	G	14: 44,560,733	Y139H		Het
Golgb1	A	C	16: 36,915,424	I1719L	probably benign	Het
Hsf1	T	C	15: 76,498,193	S255P	probably benign	Het
Ighv2-2	T	C	12: 113,588,294	D108G	probably damaging	Het
Kbtbd3	C	T	9: 4,316,878	Q10*	probably null	Het
Kcnh2	C	T	5: 24,333,036	V110M	probably benign	Het
Magi3	A	C	3: 104,016,689	L1112W	probably damaging	Het
Malrd1	T	A	2: 16,128,068	D1933E	unknown	Het
Mki67	G	A	7: 135,699,724	R1194*	probably null	Het
Nap1l1	T	C	10: 111,492,908	Y233H	probably damaging	Het
Napsa	A	G	7: 44,585,334	I298V	probably benign	Het
Nkx6-1	A	T	5: 101,663,599	S212R	probably damaging	Het
Nlrc4	A	T	17: 74,445,615	I591N	probably damaging	Het
Olfr1468-ps1	T	C	19: 13,375,067	I35T	possibly damaging	Het
Orc2	T	C	1: 58,467,668	D503G	possibly damaging	Het
Osbp	T	A	19: 11,978,248	S343T	probably benign	Het
Pcdha6	T	G	18: 36,969,426	D557E	probably damaging	Het
Pdcd11	AGAGGAGGAGGAGGAGGAGGAGGAG	AGAGGAGGAGGAGGAGGAGGAG	19: 47,113,437		probably benign	Het
Ppdpf	A	G	2: 181,187,857	Y35C	probably benign	Het
Scrn2	T	A	11: 97,030,929	L75Q	probably damaging	Het
Scube3	G	A	17: 28,171,226	V955I	probably benign	Het
Slc1a1	T	C	19: 28,911,761	V478A	probably benign	Het
Slc4a4	A	G	5: 89,058,278		probably null	Het
Srrm2	T	C	17: 23,808,110	L96P	unknown	Het

Other mutations in Strn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00722:Strn	APN	17	78692420	missense	possibly damaging	0.89
IGL02165:Strn	APN	17	78687620	missense	probably damaging	1.00
IGL02424:Strn	APN	17	78684351	missense	probably damaging	1.00
IGL02473:Strn	APN	17	78684293	missense	possibly damaging	0.71
IGL03306:Strn	APN	17	78667223	missense	probably damaging	0.98
R0053:Strn	UTSW	17	78656934	missense	possibly damaging	0.92
R0053:Strn	UTSW	17	78656934	missense	possibly damaging	0.92
R0165:Strn	UTSW	17	78677374	missense	possibly damaging	0.89
R1156:Strn	UTSW	17	78656931	missense	probably damaging	0.99
R1191:Strn	UTSW	17	78692426	missense	possibly damaging	0.82
R1256:Strn	UTSW	17	78664617	critical splice donor site	probably null
R1700:Strn	UTSW	17	78692402	missense	probably damaging	1.00
R1878:Strn	UTSW	17	78677326	missense	possibly damaging	0.81
R1897:Strn	UTSW	17	78682842	missense	probably benign	0.01
R1912:Strn	UTSW	17	78684395	missense	probably damaging	1.00
R1975:Strn	UTSW	17	78692499	splice site	probably null
R2357:Strn	UTSW	17	78655599	missense	probably damaging	1.00
R3054:Strn	UTSW	17	78682892	missense	probably damaging	0.99
R3693:Strn	UTSW	17	78656992	missense	probably damaging	1.00
R3694:Strn	UTSW	17	78656992	missense	probably damaging	1.00
R3695:Strn	UTSW	17	78656992	missense	probably damaging	1.00
R3941:Strn	UTSW	17	78657940	missense	probably damaging	0.99
R4431:Strn	UTSW	17	78736462	missense	probably damaging	1.00
R4570:Strn	UTSW	17	78677372	missense	possibly damaging	0.95
R4678:Strn	UTSW	17	78677351	missense	probably damaging	1.00
R4729:Strn	UTSW	17	78657961	missense	probably damaging	0.98
R4947:Strn	UTSW	17	78661779	missense	probably damaging	0.98
R5470:Strn	UTSW	17	78656945	missense	probably benign	0.01
R5710:Strn	UTSW	17	78687599	missense	probably damaging	1.00
R5943:Strn	UTSW	17	78669847	missense	probably damaging	0.96
R6173:Strn	UTSW	17	78700869	missense	probably damaging	1.00
R6800:Strn	UTSW	17	78670358	intron	probably benign
R6846:Strn	UTSW	17	78736457	missense	probably damaging	0.97
R7716:Strn	UTSW	17	78655775	missense	probably damaging	0.99
R7746:Strn	UTSW	17	78677372	missense	probably benign	0.11
R7997:Strn	UTSW	17	78684243	missense	probably benign	0.01
R8344:Strn	UTSW	17	78672647	missense	probably damaging	1.00
RF006:Strn	UTSW	17	78677271	frame shift	probably null
RF008:Strn	UTSW	17	78677287	frame shift	probably null
RF017:Strn	UTSW	17	78677288	frame shift	probably null
RF018:Strn	UTSW	17	78677283	frame shift	probably null
RF031:Strn	UTSW	17	78677277	frame shift	probably null
RF035:Strn	UTSW	17	78677285	frame shift	probably null
RF036:Strn	UTSW	17	78677277	frame shift	probably null
RF038:Strn	UTSW	17	78677282	frame shift	probably null
RF039:Strn	UTSW	17	78677278	frame shift	probably null
RF044:Strn	UTSW	17	78677288	frame shift	probably null
RF045:Strn	UTSW	17	78677282	frame shift	probably null
RF047:Strn	UTSW	17	78677270	frame shift	probably null
RF047:Strn	UTSW	17	78677274	frame shift	probably null
RF048:Strn	UTSW	17	78677287	frame shift	probably null
X0022:Strn	UTSW	17	78700949	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGAACTCAGTTGAACAGTAACTC -3'
(R):5'- TTGAGCCGTTACCCATTGTAAAC -3'

Sequencing Primer
(F):5'- AGTAACTCTGCTGCTTGCTTAAG -3'
(R):5'- AGCCGTTACCCATTGTAAACTTTTTG -3'

Posted On

2020-09-15