Incidental Mutation 'R7950:Slc1a1'
ID649533
Institutional Source Beutler Lab
Gene Symbol Slc1a1
Ensembl Gene ENSMUSG00000024935
Gene Namesolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
SynonymsD130048G10Rik, MEAAC1, EAAC1, EAAT3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7950 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location28835049-28913960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28911761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 478 (V478A)
Ref Sequence ENSEMBL: ENSMUSP00000025875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025875] [ENSMUST00000175647] [ENSMUST00000179171]
Predicted Effect probably benign
Transcript: ENSMUST00000025875
AA Change: V478A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000025875
Gene: ENSMUSG00000024935
AA Change: V478A

DomainStartEndE-ValueType
Pfam:SDF 20 464 2.3e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175647
SMART Domains Protein: ENSMUSP00000135813
Gene: ENSMUSG00000064202

DomainStartEndE-ValueType
Pfam:SPATA6 6 78 4.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179171
SMART Domains Protein: ENSMUSP00000137486
Gene: ENSMUSG00000064202

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the high-affinity glutamate transporters that play an essential role in transporting glutamate across plasma membranes. In brain, these transporters are crucial in terminating the postsynaptic action of the neurotransmitter glutamate, and in maintaining extracellular glutamate concentrations below neurotoxic levels. This transporter also transports aspartate, and mutations in this gene are thought to cause dicarboxylicamino aciduria, also known as glutamate-aspartate transport defect. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced locomotor activity and excessive excretion of glutamate and aspartate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,979,767 T31I probably damaging Het
Adgrf5 G A 17: 43,451,157 V1248M probably damaging Het
Alb T C 5: 90,472,464 S478P probably damaging Het
Arhgap17 A G 7: 123,286,816 S698P probably benign Het
Arhgef5 A G 6: 43,273,925 T537A possibly damaging Het
Arl6 A T 16: 59,618,731 probably null Het
Atp13a4 A T 16: 29,449,917 W540R Het
Birc6 A T 17: 74,593,100 D1091V probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
C130074G19Rik T C 1: 184,874,374 probably null Het
C1ql4 T A 15: 99,084,812 H220L probably benign Het
Cacna1s A G 1: 136,100,625 N1147S probably benign Het
Cc2d2a T C 5: 43,695,296 probably null Het
Ccdc36 T C 9: 108,405,671 T273A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Ecel1 A T 1: 87,148,269 Y729N probably damaging Het
Epha4 T A 1: 77,507,196 I59F probably damaging Het
Filip1l A G 16: 57,569,711 K221E probably damaging Het
Flnc A G 6: 29,456,382 E2193G possibly damaging Het
Galnt10 C G 11: 57,783,723 P513A probably damaging Het
Gm5624 A G 14: 44,560,733 Y139H Het
Golgb1 A C 16: 36,915,424 I1719L probably benign Het
Hsf1 T C 15: 76,498,193 S255P probably benign Het
Ighv2-2 T C 12: 113,588,294 D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 Q10* probably null Het
Kcnh2 C T 5: 24,333,036 V110M probably benign Het
Magi3 A C 3: 104,016,689 L1112W probably damaging Het
Malrd1 T A 2: 16,128,068 D1933E unknown Het
Mki67 G A 7: 135,699,724 R1194* probably null Het
Nap1l1 T C 10: 111,492,908 Y233H probably damaging Het
Napsa A G 7: 44,585,334 I298V probably benign Het
Nkx6-1 A T 5: 101,663,599 S212R probably damaging Het
Nlrc4 A T 17: 74,445,615 I591N probably damaging Het
Olfr1468-ps1 T C 19: 13,375,067 I35T possibly damaging Het
Orc2 T C 1: 58,467,668 D503G possibly damaging Het
Osbp T A 19: 11,978,248 S343T probably benign Het
Pcdha6 T G 18: 36,969,426 D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Ppdpf A G 2: 181,187,857 Y35C probably benign Het
Scrn2 T A 11: 97,030,929 L75Q probably damaging Het
Scube3 G A 17: 28,171,226 V955I probably benign Het
Slc4a4 A G 5: 89,058,278 probably null Het
Srrm2 T C 17: 23,808,110 L96P unknown Het
Strn A T 17: 78,670,423 L175Q Het
Other mutations in Slc1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Slc1a1 APN 19 28902753 missense possibly damaging 0.66
IGL02726:Slc1a1 APN 19 28911769 missense probably benign 0.04
IGL02865:Slc1a1 APN 19 28905338 missense probably damaging 1.00
R0008:Slc1a1 UTSW 19 28901484 missense probably benign 0.01
R0008:Slc1a1 UTSW 19 28901484 missense probably benign 0.01
R0490:Slc1a1 UTSW 19 28897531 missense probably benign
R1219:Slc1a1 UTSW 19 28904746 splice site probably benign
R1333:Slc1a1 UTSW 19 28835211 start gained probably benign
R1623:Slc1a1 UTSW 19 28904722 missense probably benign 0.09
R1669:Slc1a1 UTSW 19 28911794 missense probably benign 0.04
R1746:Slc1a1 UTSW 19 28894469 missense probably benign 0.31
R2516:Slc1a1 UTSW 19 28892912 missense probably benign 0.31
R4198:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4199:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4200:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4432:Slc1a1 UTSW 19 28902709 missense probably benign 0.21
R4744:Slc1a1 UTSW 19 28894525 missense probably benign
R5110:Slc1a1 UTSW 19 28911808 missense probably benign 0.14
R5341:Slc1a1 UTSW 19 28897568 missense probably benign
R6136:Slc1a1 UTSW 19 28905410 missense probably damaging 1.00
R6153:Slc1a1 UTSW 19 28909535 missense probably damaging 0.98
R6640:Slc1a1 UTSW 19 28894570 critical splice donor site probably null
R8182:Slc1a1 UTSW 19 28901448 missense probably benign 0.07
RF020:Slc1a1 UTSW 19 28879155 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCTTTAGAAACCACCCTCTG -3'
(R):5'- ATCCCAGGCCTCAATCTGAG -3'

Sequencing Primer
(F):5'- TTCCTTTCTCCATACGACAGAGGAG -3'
(R):5'- TCAATCTGAGGTCAGGCATC -3'
Posted On2020-09-15