Incidental Mutation 'R7951:Olfr1162'
ID649538
Institutional Source Beutler Lab
Gene Symbol Olfr1162
Ensembl Gene ENSMUSG00000075139
Gene Nameolfactory receptor 1162
SynonymsMOR174-14, GA_x6K02T2Q125-49542541-49541597
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7951 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88045920-88051129 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 88050257 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 122 (Y122*)
Ref Sequence ENSEMBL: ENSMUSP00000139068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099837] [ENSMUST00000183862]
Predicted Effect probably null
Transcript: ENSMUST00000099837
AA Change: Y122*
SMART Domains Protein: ENSMUSP00000097425
Gene: ENSMUSG00000075139
AA Change: Y122*

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.9e-46 PFAM
Pfam:7tm_1 43 292 1.5e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000183862
AA Change: Y122*
SMART Domains Protein: ENSMUSP00000139068
Gene: ENSMUSG00000075139
AA Change: Y122*

DomainStartEndE-ValueType
Pfam:7tm_1 43 292 4.2e-27 PFAM
Pfam:7tm_4 141 285 3.1e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 G A 17: 84,697,529 G575S probably damaging Het
Acacb G T 5: 114,188,340 A256S probably damaging Het
Adamts20 T C 15: 94,341,066 D757G probably damaging Het
Adgra3 A G 5: 49,963,784 V834A probably damaging Het
Adgrv1 A G 13: 81,563,570 S1096P probably damaging Het
Arntl2 T G 6: 146,813,234 L135R probably damaging Het
Cct4 T C 11: 22,990,868 S39P probably benign Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Col11a1 T A 3: 114,095,215 D302E unknown Het
D5Ertd579e C T 5: 36,615,173 S626N probably benign Het
Dido1 A T 2: 180,670,881 C1074S probably benign Het
Dnah17 C T 11: 118,118,766 R660H possibly damaging Het
Dnhd1 A T 7: 105,678,004 D720V probably damaging Het
Dst T C 1: 34,201,186 M1872T probably benign Het
Enpp2 T C 15: 54,919,693 I13M probably benign Het
Fcho1 A G 8: 71,712,276 F454L probably benign Het
Gad2 A G 2: 22,623,487 K43R probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Hey1 A G 3: 8,664,872 L175P possibly damaging Het
Jade1 G A 3: 41,591,755 V72M probably damaging Het
Klhl28 G A 12: 64,957,101 R213W probably damaging Het
Kprp C T 3: 92,824,330 R471H unknown Het
Lmtk3 A T 7: 45,785,606 M27L probably benign Het
Lrp1 A T 10: 127,539,064 Y4508* probably null Het
Lypd5 T C 7: 24,351,635 V57A probably damaging Het
Mapk9 T G 11: 49,863,595 S58R probably damaging Het
Mycbp2 T C 14: 103,215,462 K1661R probably damaging Het
Myl2 C T 5: 122,106,687 A140V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nckap1l T C 15: 103,473,115 Y428H probably damaging Het
Nt5c1a T C 4: 123,212,185 F144S probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr1168 G T 2: 88,185,272 V132F probably damaging Het
Olfr1186 A T 2: 88,525,804 T74S probably damaging Het
Pabpc4 T G 4: 123,283,739 V42G probably damaging Het
Prrc2a A T 17: 35,160,501 N311K unknown Het
Rcbtb2 A T 14: 73,166,552 R197* probably null Het
Rfc4 A G 16: 23,115,385 I222T probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Rufy1 T C 11: 50,430,909 D66G probably benign Het
Rxfp1 A T 3: 79,652,375 C380S probably damaging Het
Scn5a A G 9: 119,529,079 C699R probably damaging Het
Syngap1 G T 17: 26,966,968 A1291S possibly damaging Het
Tab1 C A 15: 80,158,857 N417K probably damaging Het
Tenm3 A G 8: 48,310,703 V772A possibly damaging Het
Tmem25 T A 9: 44,795,493 K285I probably damaging Het
Tnks2 A G 19: 36,862,155 N51D Het
Trpm7 G A 2: 126,813,268 T1250I possibly damaging Het
Trpv4 T C 5: 114,622,810 D820G probably benign Het
Tsg101 T A 7: 46,891,143 I289L probably benign Het
Tubgcp2 C A 7: 140,007,980 R244L possibly damaging Het
Vmn1r173 C A 7: 23,703,255 T305K unknown Het
Vmn1r53 A T 6: 90,224,150 I64K possibly damaging Het
Zfp444 T C 7: 6,188,186 V122A probably benign Het
Zfp599 A G 9: 22,249,468 L467P probably damaging Het
Zic1 T C 9: 91,362,601 E335G probably damaging Het
Other mutations in Olfr1162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Olfr1162 APN 2 88049784 missense possibly damaging 0.63
IGL01965:Olfr1162 APN 2 88050436 missense probably benign 0.14
IGL02183:Olfr1162 APN 2 88049989 missense possibly damaging 0.96
R0281:Olfr1162 UTSW 2 88050412 missense possibly damaging 0.96
R0501:Olfr1162 UTSW 2 88050471 missense probably damaging 1.00
R4254:Olfr1162 UTSW 2 88049779 missense possibly damaging 0.62
R4589:Olfr1162 UTSW 2 88050479 missense probably benign 0.12
R4824:Olfr1162 UTSW 2 88050088 missense probably damaging 1.00
R5148:Olfr1162 UTSW 2 88050393 missense probably benign 0.08
R5580:Olfr1162 UTSW 2 88050324 missense possibly damaging 0.79
R6174:Olfr1162 UTSW 2 88050302 nonsense probably null
R6888:Olfr1162 UTSW 2 88050264 missense probably damaging 1.00
R7935:Olfr1162 UTSW 2 88049946 missense probably damaging 1.00
Z1177:Olfr1162 UTSW 2 88050304 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGAAGAAGTGGTTGATCAC -3'
(R):5'- GGAAACCTTGGGATGATAGCAC -3'

Sequencing Primer
(F):5'- GAAGTGGTTGATCACATTAAATCTTG -3'
(R):5'- AAGTTCCACACTCCAATGTACTTC -3'
Posted On2020-09-15