Incidental Mutation 'R7951:Nt5c1a'
ID649548
Institutional Source Beutler Lab
Gene Symbol Nt5c1a
Ensembl Gene ENSMUSG00000054958
Gene Name5'-nucleotidase, cytosolic IA
SynonymsLOC230718, Cn1a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7951 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location123201504-123216275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123212185 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 144 (F144S)
Ref Sequence ENSEMBL: ENSMUSP00000069422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068262]
Predicted Effect probably benign
Transcript: ENSMUST00000068262
AA Change: F144S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000069422
Gene: ENSMUSG00000054958
AA Change: F144S

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Pfam:5-nucleotidase 78 350 3.5e-109 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic nucleotidases, such as NT5C1A, dephosphorylate nucleoside monophosphates (Hunsucker et al., 2001 [PubMed 11133996]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 G A 17: 84,697,529 G575S probably damaging Het
Acacb G T 5: 114,188,340 A256S probably damaging Het
Adamts20 T C 15: 94,341,066 D757G probably damaging Het
Adgra3 A G 5: 49,963,784 V834A probably damaging Het
Adgrv1 A G 13: 81,563,570 S1096P probably damaging Het
Arntl2 T G 6: 146,813,234 L135R probably damaging Het
Cct4 T C 11: 22,990,868 S39P probably benign Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Col11a1 T A 3: 114,095,215 D302E unknown Het
D5Ertd579e C T 5: 36,615,173 S626N probably benign Het
Dido1 A T 2: 180,670,881 C1074S probably benign Het
Dnah17 C T 11: 118,118,766 R660H possibly damaging Het
Dnhd1 A T 7: 105,678,004 D720V probably damaging Het
Dst T C 1: 34,201,186 M1872T probably benign Het
Enpp2 T C 15: 54,919,693 I13M probably benign Het
Fcho1 A G 8: 71,712,276 F454L probably benign Het
Gad2 A G 2: 22,623,487 K43R probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Hey1 A G 3: 8,664,872 L175P possibly damaging Het
Jade1 G A 3: 41,591,755 V72M probably damaging Het
Klhl28 G A 12: 64,957,101 R213W probably damaging Het
Kprp C T 3: 92,824,330 R471H unknown Het
Lmtk3 A T 7: 45,785,606 M27L probably benign Het
Lrp1 A T 10: 127,539,064 Y4508* probably null Het
Lypd5 T C 7: 24,351,635 V57A probably damaging Het
Mapk9 T G 11: 49,863,595 S58R probably damaging Het
Mycbp2 T C 14: 103,215,462 K1661R probably damaging Het
Myl2 C T 5: 122,106,687 A140V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nckap1l T C 15: 103,473,115 Y428H probably damaging Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr1162 A T 2: 88,050,257 Y122* probably null Het
Olfr1168 G T 2: 88,185,272 V132F probably damaging Het
Olfr1186 A T 2: 88,525,804 T74S probably damaging Het
Pabpc4 T G 4: 123,283,739 V42G probably damaging Het
Prrc2a A T 17: 35,160,501 N311K unknown Het
Rcbtb2 A T 14: 73,166,552 R197* probably null Het
Rfc4 A G 16: 23,115,385 I222T probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Rufy1 T C 11: 50,430,909 D66G probably benign Het
Rxfp1 A T 3: 79,652,375 C380S probably damaging Het
Scn5a A G 9: 119,529,079 C699R probably damaging Het
Syngap1 G T 17: 26,966,968 A1291S possibly damaging Het
Tab1 C A 15: 80,158,857 N417K probably damaging Het
Tenm3 A G 8: 48,310,703 V772A possibly damaging Het
Tmem25 T A 9: 44,795,493 K285I probably damaging Het
Tnks2 A G 19: 36,862,155 N51D Het
Trpm7 G A 2: 126,813,268 T1250I possibly damaging Het
Trpv4 T C 5: 114,622,810 D820G probably benign Het
Tsg101 T A 7: 46,891,143 I289L probably benign Het
Tubgcp2 C A 7: 140,007,980 R244L possibly damaging Het
Vmn1r173 C A 7: 23,703,255 T305K unknown Het
Vmn1r53 A T 6: 90,224,150 I64K possibly damaging Het
Zfp444 T C 7: 6,188,186 V122A probably benign Het
Zfp599 A G 9: 22,249,468 L467P probably damaging Het
Zic1 T C 9: 91,362,601 E335G probably damaging Het
Other mutations in Nt5c1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Nt5c1a APN 4 123216169 missense probably damaging 1.00
IGL02035:Nt5c1a APN 4 123214102 missense possibly damaging 0.93
IGL02437:Nt5c1a APN 4 123214241 missense probably benign 0.25
IGL02877:Nt5c1a APN 4 123216074 missense probably damaging 1.00
R1628:Nt5c1a UTSW 4 123208491 missense possibly damaging 0.65
R2273:Nt5c1a UTSW 4 123216080 missense probably damaging 1.00
R2275:Nt5c1a UTSW 4 123216080 missense probably damaging 1.00
R4433:Nt5c1a UTSW 4 123215896 missense probably benign 0.01
R4826:Nt5c1a UTSW 4 123208572 missense probably damaging 1.00
R5328:Nt5c1a UTSW 4 123208993 missense possibly damaging 0.90
R5690:Nt5c1a UTSW 4 123215939 missense probably damaging 1.00
R5883:Nt5c1a UTSW 4 123216256 splice site probably null
R7162:Nt5c1a UTSW 4 123214105 missense probably benign
R7390:Nt5c1a UTSW 4 123208479 missense probably benign 0.01
R7823:Nt5c1a UTSW 4 123208572 missense probably damaging 1.00
R8121:Nt5c1a UTSW 4 123208442 missense probably damaging 1.00
R8265:Nt5c1a UTSW 4 123214160 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TATGATTCCCTGACTAGGTGGAG -3'
(R):5'- ACCAGTGGGACCCCTTTATG -3'

Sequencing Primer
(F):5'- AAGCTATGAGCCAGGCGTTTTC -3'
(R):5'- AGTGGGACCCCTTTATGTGTGG -3'
Posted On2020-09-15