Incidental Mutation 'R7951:D5Ertd579e'
ID649551
Institutional Source Beutler Lab
Gene Symbol D5Ertd579e
Ensembl Gene ENSMUSG00000029190
Gene NameDNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R7951 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location36600485-36696024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36615173 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 626 (S626N)
Ref Sequence ENSEMBL: ENSMUSP00000031091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031091]
Predicted Effect probably benign
Transcript: ENSMUST00000031091
AA Change: S626N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031091
Gene: ENSMUSG00000029190
AA Change: S626N

DomainStartEndE-ValueType
Pfam:DUF4603 23 1303 N/A PFAM
low complexity region 1365 1376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132383
SMART Domains Protein: ENSMUSP00000116548
Gene: ENSMUSG00000029190

DomainStartEndE-ValueType
Pfam:DUF4603 1 1181 N/A PFAM
low complexity region 1243 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 G A 17: 84,697,529 G575S probably damaging Het
Acacb G T 5: 114,188,340 A256S probably damaging Het
Adamts20 T C 15: 94,341,066 D757G probably damaging Het
Adgra3 A G 5: 49,963,784 V834A probably damaging Het
Adgrv1 A G 13: 81,563,570 S1096P probably damaging Het
Arntl2 T G 6: 146,813,234 L135R probably damaging Het
Cct4 T C 11: 22,990,868 S39P probably benign Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Col11a1 T A 3: 114,095,215 D302E unknown Het
Dido1 A T 2: 180,670,881 C1074S probably benign Het
Dnah17 C T 11: 118,118,766 R660H possibly damaging Het
Dnhd1 A T 7: 105,678,004 D720V probably damaging Het
Dst T C 1: 34,201,186 M1872T probably benign Het
Enpp2 T C 15: 54,919,693 I13M probably benign Het
Fcho1 A G 8: 71,712,276 F454L probably benign Het
Gad2 A G 2: 22,623,487 K43R probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Hey1 A G 3: 8,664,872 L175P possibly damaging Het
Jade1 G A 3: 41,591,755 V72M probably damaging Het
Klhl28 G A 12: 64,957,101 R213W probably damaging Het
Kprp C T 3: 92,824,330 R471H unknown Het
Lmtk3 A T 7: 45,785,606 M27L probably benign Het
Lrp1 A T 10: 127,539,064 Y4508* probably null Het
Lypd5 T C 7: 24,351,635 V57A probably damaging Het
Mapk9 T G 11: 49,863,595 S58R probably damaging Het
Mycbp2 T C 14: 103,215,462 K1661R probably damaging Het
Myl2 C T 5: 122,106,687 A140V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nckap1l T C 15: 103,473,115 Y428H probably damaging Het
Nt5c1a T C 4: 123,212,185 F144S probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr1162 A T 2: 88,050,257 Y122* probably null Het
Olfr1168 G T 2: 88,185,272 V132F probably damaging Het
Olfr1186 A T 2: 88,525,804 T74S probably damaging Het
Pabpc4 T G 4: 123,283,739 V42G probably damaging Het
Prrc2a A T 17: 35,160,501 N311K unknown Het
Rcbtb2 A T 14: 73,166,552 R197* probably null Het
Rfc4 A G 16: 23,115,385 I222T probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Rufy1 T C 11: 50,430,909 D66G probably benign Het
Rxfp1 A T 3: 79,652,375 C380S probably damaging Het
Scn5a A G 9: 119,529,079 C699R probably damaging Het
Syngap1 G T 17: 26,966,968 A1291S possibly damaging Het
Tab1 C A 15: 80,158,857 N417K probably damaging Het
Tenm3 A G 8: 48,310,703 V772A possibly damaging Het
Tmem25 T A 9: 44,795,493 K285I probably damaging Het
Tnks2 A G 19: 36,862,155 N51D Het
Trpm7 G A 2: 126,813,268 T1250I possibly damaging Het
Trpv4 T C 5: 114,622,810 D820G probably benign Het
Tsg101 T A 7: 46,891,143 I289L probably benign Het
Tubgcp2 C A 7: 140,007,980 R244L possibly damaging Het
Vmn1r173 C A 7: 23,703,255 T305K unknown Het
Vmn1r53 A T 6: 90,224,150 I64K possibly damaging Het
Zfp444 T C 7: 6,188,186 V122A probably benign Het
Zfp599 A G 9: 22,249,468 L467P probably damaging Het
Zic1 T C 9: 91,362,601 E335G probably damaging Het
Other mutations in D5Ertd579e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:D5Ertd579e APN 5 36618754 missense probably damaging 0.99
IGL01925:D5Ertd579e APN 5 36614284 missense possibly damaging 0.67
IGL01933:D5Ertd579e APN 5 36615756 missense probably benign
IGL02164:D5Ertd579e APN 5 36614959 missense probably damaging 1.00
IGL02399:D5Ertd579e APN 5 36616185 missense probably damaging 1.00
IGL02896:D5Ertd579e APN 5 36613982 missense possibly damaging 0.70
IGL03141:D5Ertd579e APN 5 36613277 missense possibly damaging 0.94
IGL03235:D5Ertd579e APN 5 36618828 splice site probably benign
R0201:D5Ertd579e UTSW 5 36616465 missense probably damaging 1.00
R0377:D5Ertd579e UTSW 5 36604567 missense probably benign 0.12
R0830:D5Ertd579e UTSW 5 36613757 missense probably damaging 1.00
R0926:D5Ertd579e UTSW 5 36672866 missense probably damaging 1.00
R1350:D5Ertd579e UTSW 5 36613737 missense probably damaging 1.00
R1448:D5Ertd579e UTSW 5 36602739 missense probably benign
R1672:D5Ertd579e UTSW 5 36613277 missense possibly damaging 0.50
R1676:D5Ertd579e UTSW 5 36616109 missense probably benign 0.01
R1693:D5Ertd579e UTSW 5 36614097 missense probably damaging 0.98
R1698:D5Ertd579e UTSW 5 36604530 missense probably benign
R1868:D5Ertd579e UTSW 5 36616427 missense probably damaging 0.99
R1909:D5Ertd579e UTSW 5 36614058 missense probably benign 0.21
R2034:D5Ertd579e UTSW 5 36613538 nonsense probably null
R2080:D5Ertd579e UTSW 5 36616206 missense probably benign 0.01
R2105:D5Ertd579e UTSW 5 36613449 missense probably benign 0.12
R2197:D5Ertd579e UTSW 5 36614793 missense possibly damaging 0.69
R4212:D5Ertd579e UTSW 5 36614479 missense probably damaging 0.99
R4452:D5Ertd579e UTSW 5 36616470 missense probably damaging 1.00
R4626:D5Ertd579e UTSW 5 36614559 missense possibly damaging 0.92
R4804:D5Ertd579e UTSW 5 36629652 splice site probably null
R4898:D5Ertd579e UTSW 5 36614941 missense probably damaging 0.99
R4917:D5Ertd579e UTSW 5 36615816 missense probably damaging 1.00
R4960:D5Ertd579e UTSW 5 36616227 nonsense probably null
R4973:D5Ertd579e UTSW 5 36672905 missense probably benign
R5092:D5Ertd579e UTSW 5 36602703 missense probably benign 0.18
R5474:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5475:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5476:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5477:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5801:D5Ertd579e UTSW 5 36604569 missense probably damaging 1.00
R6019:D5Ertd579e UTSW 5 36629692 missense possibly damaging 0.90
R6184:D5Ertd579e UTSW 5 36629783 missense probably damaging 0.99
R6213:D5Ertd579e UTSW 5 36602634 missense probably damaging 1.00
R6244:D5Ertd579e UTSW 5 36615276 missense probably damaging 0.98
R6276:D5Ertd579e UTSW 5 36604514 missense possibly damaging 0.66
R6285:D5Ertd579e UTSW 5 36615577 missense probably damaging 1.00
R6358:D5Ertd579e UTSW 5 36616236 splice site probably null
R6875:D5Ertd579e UTSW 5 36604657 splice site probably null
R6967:D5Ertd579e UTSW 5 36615756 missense probably benign
R7139:D5Ertd579e UTSW 5 36613976 missense probably damaging 1.00
R7329:D5Ertd579e UTSW 5 36616395 missense probably benign 0.21
R7464:D5Ertd579e UTSW 5 36613785 missense probably damaging 0.99
R7664:D5Ertd579e UTSW 5 36614617 missense probably benign 0.00
R7762:D5Ertd579e UTSW 5 36613381 missense
R8175:D5Ertd579e UTSW 5 36615470 missense probably damaging 1.00
R8217:D5Ertd579e UTSW 5 36614058 missense probably benign 0.00
R8233:D5Ertd579e UTSW 5 36615244 missense probably damaging 0.99
R8281:D5Ertd579e UTSW 5 36613320 missense
R8398:D5Ertd579e UTSW 5 36614277 nonsense probably null
RF022:D5Ertd579e UTSW 5 36614662 missense probably damaging 1.00
X0019:D5Ertd579e UTSW 5 36613958 missense probably damaging 1.00
Z1176:D5Ertd579e UTSW 5 36615762 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTCGTTTTCTTCAAAGGCAC -3'
(R):5'- GATTCTACCAGCTCTGTGGG -3'

Sequencing Primer
(F):5'- GGTCCATATGAGCAATCTAGACTGTG -3'
(R):5'- GTGCTGAGGGCTTCTTCC -3'
Posted On2020-09-15