Incidental Mutation 'R7951:Fcho1'
ID 649567
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # R7951 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71708387-71725716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71712276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 454 (F454L)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000125092] [ENSMUST00000136640] [ENSMUST00000146100] [ENSMUST00000153800]
AlphaFold Q8K285
Predicted Effect probably benign
Transcript: ENSMUST00000093444
AA Change: F454L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: F454L

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125092
SMART Domains Protein: ENSMUSP00000123554
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 88 7.62e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136640
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146100
AA Change: F454L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: F454L

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153800
SMART Domains Protein: ENSMUSP00000116135
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 G A 17: 84,697,529 G575S probably damaging Het
Acacb G T 5: 114,188,340 A256S probably damaging Het
Adamts20 T C 15: 94,341,066 D757G probably damaging Het
Adgra3 A G 5: 49,963,784 V834A probably damaging Het
Adgrv1 A G 13: 81,563,570 S1096P probably damaging Het
Arntl2 T G 6: 146,813,234 L135R probably damaging Het
Cct4 T C 11: 22,990,868 S39P probably benign Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Col11a1 T A 3: 114,095,215 D302E unknown Het
D5Ertd579e C T 5: 36,615,173 S626N probably benign Het
Dido1 A T 2: 180,670,881 C1074S probably benign Het
Dnah17 C T 11: 118,118,766 R660H possibly damaging Het
Dnhd1 A T 7: 105,678,004 D720V probably damaging Het
Dst T C 1: 34,201,186 M1872T probably benign Het
Enpp2 T C 15: 54,919,693 I13M probably benign Het
Gad2 A G 2: 22,623,487 K43R probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Hey1 A G 3: 8,664,872 L175P possibly damaging Het
Jade1 G A 3: 41,591,755 V72M probably damaging Het
Klhl28 G A 12: 64,957,101 R213W probably damaging Het
Kprp C T 3: 92,824,330 R471H unknown Het
Lmtk3 A T 7: 45,785,606 M27L probably benign Het
Lrp1 A T 10: 127,539,064 Y4508* probably null Het
Lypd5 T C 7: 24,351,635 V57A probably damaging Het
Mapk9 T G 11: 49,863,595 S58R probably damaging Het
Mycbp2 T C 14: 103,215,462 K1661R probably damaging Het
Myl2 C T 5: 122,106,687 A140V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nckap1l T C 15: 103,473,115 Y428H probably damaging Het
Nt5c1a T C 4: 123,212,185 F144S probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr1162 A T 2: 88,050,257 Y122* probably null Het
Olfr1168 G T 2: 88,185,272 V132F probably damaging Het
Olfr1186 A T 2: 88,525,804 T74S probably damaging Het
Pabpc4 T G 4: 123,283,739 V42G probably damaging Het
Prrc2a A T 17: 35,160,501 N311K unknown Het
Rcbtb2 A T 14: 73,166,552 R197* probably null Het
Rfc4 A G 16: 23,115,385 I222T probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Rufy1 T C 11: 50,430,909 D66G probably benign Het
Rxfp1 A T 3: 79,652,375 C380S probably damaging Het
Scn5a A G 9: 119,529,079 C699R probably damaging Het
Syngap1 G T 17: 26,966,968 A1291S possibly damaging Het
Tab1 C A 15: 80,158,857 N417K probably damaging Het
Tenm3 A G 8: 48,310,703 V772A possibly damaging Het
Tmem25 T A 9: 44,795,493 K285I probably damaging Het
Tnks2 A G 19: 36,862,155 N51D Het
Trpm7 G A 2: 126,813,268 T1250I possibly damaging Het
Trpv4 T C 5: 114,622,810 D820G probably benign Het
Tsg101 T A 7: 46,891,143 I289L probably benign Het
Tubgcp2 C A 7: 140,007,980 R244L possibly damaging Het
Vmn1r173 C A 7: 23,703,255 T305K unknown Het
Vmn1r53 A T 6: 90,224,150 I64K possibly damaging Het
Zfp444 T C 7: 6,188,186 V122A probably benign Het
Zfp599 A G 9: 22,249,468 L467P probably damaging Het
Zic1 T C 9: 91,362,601 E335G probably damaging Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 71713523 nonsense probably null
IGL01291:Fcho1 APN 8 71712547 missense probably benign 0.08
IGL01473:Fcho1 APN 8 71712138 missense probably benign 0.03
IGL02021:Fcho1 APN 8 71721275 missense probably benign 0.06
IGL02086:Fcho1 APN 8 71716800 missense probably damaging 1.00
IGL02808:Fcho1 APN 8 71712541 missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 71717430 splice site probably benign
IGL03267:Fcho1 APN 8 71712299 unclassified probably benign
cameo UTSW 8 71716863 missense possibly damaging 0.92
Lesser UTSW 8 71712560 missense probably benign 0.00
Sidekick UTSW 8 71715725 missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 71712547 missense probably benign 0.08
R0003:Fcho1 UTSW 8 71708953 missense probably damaging 1.00
R0010:Fcho1 UTSW 8 71709999 missense probably damaging 1.00
R0020:Fcho1 UTSW 8 71716870 missense probably benign 0.11
R0363:Fcho1 UTSW 8 71717490 missense probably damaging 1.00
R0457:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0485:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0501:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0502:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0551:Fcho1 UTSW 8 71712174 missense probably benign 0.06
R0583:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0584:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0585:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0612:Fcho1 UTSW 8 71715524 missense probably damaging 1.00
R0614:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0647:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0841:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0842:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1034:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1036:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1399:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1618:Fcho1 UTSW 8 71710403 missense probably damaging 0.98
R1754:Fcho1 UTSW 8 71711246 missense probably benign
R1793:Fcho1 UTSW 8 71709022 nonsense probably null
R2073:Fcho1 UTSW 8 71710489 missense probably damaging 0.98
R2177:Fcho1 UTSW 8 71712261 missense probably damaging 1.00
R4072:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4074:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4076:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4606:Fcho1 UTSW 8 71712480 missense probably benign
R4732:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4733:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R5082:Fcho1 UTSW 8 71717185 missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 71717176 missense probably benign 0.00
R5185:Fcho1 UTSW 8 71714956 unclassified probably benign
R6025:Fcho1 UTSW 8 71712573 splice site probably null
R6624:Fcho1 UTSW 8 71709371 missense probably damaging 0.99
R6875:Fcho1 UTSW 8 71714425 splice site probably null
R7069:Fcho1 UTSW 8 71710497 splice site probably null
R7476:Fcho1 UTSW 8 71713546 missense probably damaging 1.00
R7512:Fcho1 UTSW 8 71716863 missense possibly damaging 0.92
R8699:Fcho1 UTSW 8 71709633 missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 71717146 missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 71716824 missense probably benign 0.03
R9447:Fcho1 UTSW 8 71717269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGGTCATCAGATGGTACCC -3'
(R):5'- GCAGAAGGCCATATTGGGTG -3'

Sequencing Primer
(F):5'- TCAGATGGTACCCCCTATGAAGG -3'
(R):5'- AGGCCATATTGGGTGGGGATTTG -3'
Posted On 2020-09-15