Incidental Mutation 'R7952:Acbd3'
ID649596
Institutional Source Beutler Lab
Gene Symbol Acbd3
Ensembl Gene ENSMUSG00000026499
Gene Nameacyl-Coenzyme A binding domain containing 3
SynonymsD1Ertd10e, 8430407O11Rik, Pap7, Gocap1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location180726043-180754204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180752338 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 516 (S516P)
Ref Sequence ENSEMBL: ENSMUSP00000027780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027780]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027780
AA Change: S516P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027780
Gene: ENSMUSG00000026499
AA Change: S516P

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ACBP 81 167 3.2e-18 PFAM
coiled coil region 173 252 N/A INTRINSIC
low complexity region 268 305 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Pfam:GOLD_2 394 524 2.5e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192748
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is involved in the maintenance of Golgi structure and function through its interaction with the integral membrane protein giantin. It may also be involved in the hormonal regulation of steroid formation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in Acbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03215:Acbd3 APN 1 180745105 missense possibly damaging 0.61
R0321:Acbd3 UTSW 1 180752305 missense probably damaging 1.00
R0365:Acbd3 UTSW 1 180738612 missense probably damaging 1.00
R0524:Acbd3 UTSW 1 180747059 small deletion probably benign
R0733:Acbd3 UTSW 1 180752218 missense possibly damaging 0.75
R0884:Acbd3 UTSW 1 180747059 small deletion probably benign
R1074:Acbd3 UTSW 1 180738548 nonsense probably null
R1327:Acbd3 UTSW 1 180733183 missense possibly damaging 0.95
R1352:Acbd3 UTSW 1 180738530 missense probably damaging 1.00
R1820:Acbd3 UTSW 1 180745138 missense probably benign 0.13
R4697:Acbd3 UTSW 1 180721944 unclassified probably benign
R5187:Acbd3 UTSW 1 180736732 nonsense probably null
R5217:Acbd3 UTSW 1 180726373 missense probably benign 0.18
R5368:Acbd3 UTSW 1 180722095 unclassified probably benign
R6018:Acbd3 UTSW 1 180752338 missense possibly damaging 0.88
R7072:Acbd3 UTSW 1 180726369 missense probably benign
R7366:Acbd3 UTSW 1 180734499 missense probably benign 0.41
R8260:Acbd3 UTSW 1 180738530 missense probably damaging 1.00
R8267:Acbd3 UTSW 1 180746848 missense probably damaging 1.00
R8327:Acbd3 UTSW 1 180738593 missense probably damaging 0.98
R8356:Acbd3 UTSW 1 180726316 missense probably benign
R8848:Acbd3 UTSW 1 180734519 critical splice donor site probably null
X0027:Acbd3 UTSW 1 180747030 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGGTCTAACACTTGACTTGTGTC -3'
(R):5'- AGTCTCAAGGAATCCTGGTTCTC -3'

Sequencing Primer
(F):5'- CCGTCTCACAGAAAATGTCACTTGTG -3'
(R):5'- CTCAAGGAATCCTGGTTCTCAATGAG -3'
Posted On2020-09-15