Incidental Mutation 'R7952:Galnt3'
ID649597
Institutional Source Beutler Lab
Gene Symbol Galnt3
Ensembl Gene ENSMUSG00000026994
Gene Namepolypeptide N-acetylgalactosaminyltransferase 3
SynonymsppGaNTase-T3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.436) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location66082766-66124994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66097842 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 237 (E237K)
Ref Sequence ENSEMBL: ENSMUSP00000028378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028378]
Predicted Effect probably benign
Transcript: ENSMUST00000028378
AA Change: E237K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028378
Gene: ENSMUSG00000026994
AA Change: E237K

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 185 440 8.3e-10 PFAM
Pfam:Glycos_transf_2 188 374 1.2e-35 PFAM
Pfam:Glyco_transf_7C 345 423 7.7e-14 PFAM
RICIN 506 630 2.71e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating alkaline phosphatase, hypercalcemia, hyperphosphatemia, decreased circulating parathyroid hormone, and male specific postnatal growth retardation, infertility, and increase in bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in Galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Galnt3 APN 2 66095284 missense probably damaging 1.00
IGL01563:Galnt3 APN 2 66097757 missense probably damaging 0.97
IGL01973:Galnt3 APN 2 66084262 missense probably benign 0.03
IGL02004:Galnt3 APN 2 66095926 missense probably damaging 1.00
IGL02424:Galnt3 APN 2 66095788 critical splice donor site probably null
IGL02946:Galnt3 APN 2 66095218 missense probably damaging 0.99
IGL03059:Galnt3 APN 2 66093610 missense probably damaging 1.00
PIT4531001:Galnt3 UTSW 2 66107088 missense probably benign 0.03
R0437:Galnt3 UTSW 2 66107229 missense possibly damaging 0.74
R1390:Galnt3 UTSW 2 66091223 missense probably damaging 1.00
R1536:Galnt3 UTSW 2 66084206 missense probably damaging 1.00
R1869:Galnt3 UTSW 2 66097779 missense possibly damaging 0.82
R2987:Galnt3 UTSW 2 66084241 missense probably benign 0.00
R3973:Galnt3 UTSW 2 66107030 missense possibly damaging 0.77
R4039:Galnt3 UTSW 2 66085327 missense probably damaging 0.96
R4515:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4518:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4519:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4577:Galnt3 UTSW 2 66097859 missense probably benign 0.02
R4817:Galnt3 UTSW 2 66093539 missense possibly damaging 0.83
R5008:Galnt3 UTSW 2 66085241 missense probably benign 0.04
R5191:Galnt3 UTSW 2 66093706 missense probably damaging 1.00
R5947:Galnt3 UTSW 2 66084156 utr 3 prime probably benign
R6534:Galnt3 UTSW 2 66102531 missense probably damaging 1.00
R7196:Galnt3 UTSW 2 66090924 missense probably damaging 1.00
R7817:Galnt3 UTSW 2 66095899 missense probably damaging 1.00
R7951:Galnt3 UTSW 2 66097842 missense probably benign 0.00
R8071:Galnt3 UTSW 2 66091211 missense probably benign 0.28
R8513:Galnt3 UTSW 2 66093720 nonsense probably null
R8844:Galnt3 UTSW 2 66085292 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGGAAAGTTGCAAGCCATC -3'
(R):5'- ACAGAGTAAGTCCCAGCTGCAG -3'

Sequencing Primer
(F):5'- TCTGCAAAGGGGCACTTAC -3'
(R):5'- GTAAGTCCCAGCTGCAGCATTAG -3'
Posted On2020-09-15