Incidental Mutation 'R0018:Xdh'
ID 64960
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 038313-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R0018 (G1)
Quality Score 192
Status Validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74232020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 230 (R230H)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: R230H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: R230H

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,532,162 (GRCm39) probably null Het
Afp A C 5: 90,654,600 (GRCm39) Q546P probably damaging Het
Api5 A T 2: 94,251,329 (GRCm39) probably null Het
Atp2b4 T A 1: 133,645,609 (GRCm39) I982F probably damaging Het
BC024139 G A 15: 76,005,087 (GRCm39) Q592* probably null Het
Capn7 T A 14: 31,076,069 (GRCm39) C290* probably null Het
Ccn1 A G 3: 145,355,186 (GRCm39) L23P probably damaging Het
Celsr1 T A 15: 85,915,243 (GRCm39) D910V possibly damaging Het
Chga T C 12: 102,524,764 (GRCm39) S45P probably damaging Het
Cpne2 T A 8: 95,282,681 (GRCm39) C59S possibly damaging Het
Cyp2b13 G A 7: 25,785,375 (GRCm39) R248H probably benign Het
Dennd1a T A 2: 37,748,472 (GRCm39) T336S possibly damaging Het
Drc7 A G 8: 95,800,862 (GRCm39) Y628C probably damaging Het
Dse A G 10: 34,029,464 (GRCm39) V542A probably benign Het
Dspp A T 5: 104,326,096 (GRCm39) S820C unknown Het
Efcab3 G A 11: 104,612,378 (GRCm39) probably null Het
Eif5b T C 1: 38,057,970 (GRCm39) S91P unknown Het
Epop A G 11: 97,519,017 (GRCm39) V364A probably benign Het
Ext2 G A 2: 93,626,037 (GRCm39) P341L probably damaging Het
Galns T C 8: 123,311,724 (GRCm39) T429A probably benign Het
Gsx2 A G 5: 75,237,828 (GRCm39) K260R probably damaging Het
H2-M10.6 A C 17: 37,124,941 (GRCm39) H286P probably damaging Het
Hectd4 A G 5: 121,392,242 (GRCm39) N169D possibly damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hmcn1 T C 1: 150,528,302 (GRCm39) D3282G probably benign Het
Hnmt T A 2: 23,893,640 (GRCm39) N285Y possibly damaging Het
Hr A G 14: 70,795,717 (GRCm39) R450G probably benign Het
Kat6a A G 8: 23,419,289 (GRCm39) D684G possibly damaging Het
Kif27 T G 13: 58,435,867 (GRCm39) I1309L probably benign Het
Mab21l4 T A 1: 93,082,327 (GRCm39) D264V probably benign Het
Man2b1 T A 8: 85,824,118 (GRCm39) V1005E probably damaging Het
Me2 A T 18: 73,924,923 (GRCm39) F265I possibly damaging Het
Myo9a A T 9: 59,779,007 (GRCm39) T1588S probably benign Het
Neu4 T A 1: 93,953,060 (GRCm39) D476E probably benign Het
Nlrp9c T A 7: 26,071,423 (GRCm39) Q895L possibly damaging Het
Or1e35 T C 11: 73,797,452 (GRCm39) I289V probably damaging Het
Or1p1c A C 11: 74,160,934 (GRCm39) T240P probably benign Het
Pdzd8 C T 19: 59,289,105 (GRCm39) R765H probably damaging Het
Plk1 T C 7: 121,768,208 (GRCm39) probably null Het
Ppfia2 A G 10: 106,678,647 (GRCm39) probably benign Het
Prkdc T C 16: 15,544,406 (GRCm39) Y1799H probably benign Het
Psmc1 T C 12: 100,082,951 (GRCm39) probably benign Het
Ptchd3 A C 11: 121,733,170 (GRCm39) I687L probably benign Het
Ptprh A G 7: 4,604,845 (GRCm39) probably null Het
Pus3 A G 9: 35,477,920 (GRCm39) D384G probably benign Het
Rab44 C T 17: 29,358,354 (GRCm39) P181S probably benign Het
Rasa2 A G 9: 96,454,016 (GRCm39) S307P probably damaging Het
Rbpms2 A G 9: 65,558,360 (GRCm39) D142G probably damaging Het
Reln A T 5: 22,130,369 (GRCm39) D2647E probably benign Het
Ryr2 G A 13: 11,610,109 (GRCm39) T4239I possibly damaging Het
Sctr C A 1: 119,971,286 (GRCm39) probably benign Het
Serpinb6e A T 13: 34,021,828 (GRCm39) Y167N probably damaging Het
Slc13a5 T C 11: 72,157,301 (GRCm39) I31V probably benign Het
Slc15a4 A T 5: 127,679,074 (GRCm39) I422N probably damaging Het
Stk24 G A 14: 121,545,419 (GRCm39) probably benign Het
Vmn1r213 T A 13: 23,196,311 (GRCm39) V298D probably damaging Het
Zfp418 A T 7: 7,185,449 (GRCm39) S471C probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAACCTCTCTCAGGATGCTCG -3'
(R):5'- CTGAACAGGGAACAGAGTGCCTTAC -3'

Sequencing Primer
(F):5'- TCCAAAGCCGATGTCTCG -3'
(R):5'- ACAGAGTGCCTTACTGAATGTG -3'
Posted On 2013-08-06