Incidental Mutation 'R7952:Tpx2'
ID649601
Institutional Source Beutler Lab
Gene Symbol Tpx2
Ensembl Gene ENSMUSG00000027469
Gene NameTPX2, microtubule-associated
SynonymsDIL2, p100, REPP86
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location152847964-152895321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152893594 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 714 (A714V)
Ref Sequence ENSEMBL: ENSMUSP00000028969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028969] [ENSMUST00000109816] [ENSMUST00000164120] [ENSMUST00000178997]
Predicted Effect probably damaging
Transcript: ENSMUST00000028969
AA Change: A714V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028969
Gene: ENSMUSG00000027469
AA Change: A714V

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 7.4e-39 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 360 541 1e-62 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 6.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109816
AA Change: A714V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105441
Gene: ENSMUSG00000027469
AA Change: A714V

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 7.4e-39 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 360 541 1e-62 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 6.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164120
AA Change: A714V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128888
Gene: ENSMUSG00000027469
AA Change: A714V

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 5.2e-40 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 362 489 2.7e-35 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 7.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178997
AA Change: A714V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136457
Gene: ENSMUSG00000027469
AA Change: A714V

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 5.2e-40 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 362 489 2.7e-35 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 7.5e-15 PFAM
Meta Mutation Damage Score 0.6873 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic arrest at the morula stage, embryonic lethality and tetraploidy of cultured E1.5 embryos. Mice heterozygous for the gene trap allele exhibit aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in Tpx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Tpx2 APN 2 152893591 missense probably damaging 1.00
IGL01810:Tpx2 APN 2 152884235 missense probably damaging 1.00
IGL01951:Tpx2 APN 2 152884176 missense probably benign 0.01
IGL02184:Tpx2 APN 2 152882320 nonsense probably null
IGL02422:Tpx2 APN 2 152873144 missense probably benign 0.00
IGL02441:Tpx2 APN 2 152882287 missense possibly damaging 0.88
R7952_Tpx2_601 UTSW 2 152893594 missense probably damaging 1.00
reddened UTSW 2 152869724 missense probably benign 0.00
Shamed UTSW 2 152873104 missense probably benign
R0063:Tpx2 UTSW 2 152880123 missense probably damaging 0.99
R0076:Tpx2 UTSW 2 152893683 missense probably damaging 1.00
R0271:Tpx2 UTSW 2 152867367 splice site probably benign
R0311:Tpx2 UTSW 2 152890492 missense probably damaging 0.98
R0617:Tpx2 UTSW 2 152873138 missense probably benign 0.01
R1871:Tpx2 UTSW 2 152893603 missense probably damaging 1.00
R1882:Tpx2 UTSW 2 152869691 missense probably benign
R1990:Tpx2 UTSW 2 152890624 missense probably benign
R1991:Tpx2 UTSW 2 152890624 missense probably benign
R1992:Tpx2 UTSW 2 152890624 missense probably benign
R4686:Tpx2 UTSW 2 152889183 missense possibly damaging 0.62
R4712:Tpx2 UTSW 2 152885038 missense probably damaging 1.00
R4792:Tpx2 UTSW 2 152885096 missense probably damaging 0.98
R4873:Tpx2 UTSW 2 152893615 missense probably benign 0.00
R4875:Tpx2 UTSW 2 152893615 missense probably benign 0.00
R4991:Tpx2 UTSW 2 152869724 missense probably benign 0.00
R5178:Tpx2 UTSW 2 152875549 missense probably benign 0.01
R5757:Tpx2 UTSW 2 152885231 splice site probably null
R6158:Tpx2 UTSW 2 152873104 missense probably benign
R6225:Tpx2 UTSW 2 152876628 missense probably benign
R6539:Tpx2 UTSW 2 152876598 nonsense probably null
R6633:Tpx2 UTSW 2 152867354 missense probably damaging 1.00
R7358:Tpx2 UTSW 2 152876630 missense probably benign
R7741:Tpx2 UTSW 2 152867343 missense possibly damaging 0.84
R8433:Tpx2 UTSW 2 152880136 missense probably damaging 0.99
R8888:Tpx2 UTSW 2 152882335 missense probably damaging 1.00
R8895:Tpx2 UTSW 2 152882335 missense probably damaging 1.00
R8920:Tpx2 UTSW 2 152884294 missense probably damaging 0.99
X0023:Tpx2 UTSW 2 152885028 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACGTGTTTACACATTCATGCACTG -3'
(R):5'- GAGTCATCTTCAAAACACCCGG -3'

Sequencing Primer
(F):5'- GTTTACACATTCATGCACTGAACAAC -3'
(R):5'- CCGGCATCCATTAGTTATCAGGTG -3'
Posted On2020-09-15