Incidental Mutation 'R7952:Cela3b'
ID649607
Institutional Source Beutler Lab
Gene Symbol Cela3b
Ensembl Gene ENSMUSG00000023433
Gene Namechymotrypsin-like elastase family, member 3B
Synonyms2310074F01Rik, Ela3b, Ela3, 0910001F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location137420999-137430540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137421908 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 262 (I262V)
Ref Sequence ENSEMBL: ENSMUSP00000099581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102522]
Predicted Effect probably benign
Transcript: ENSMUST00000102522
AA Change: I262V

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099581
Gene: ENSMUSG00000023433
AA Change: I262V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 27 262 8.81e-94 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, elastase 3B has little elastolytic activity. Like most of the human elastases, elastase 3B is secreted from the pancreas as a zymogen and, like other serine proteases such as trypsin, chymotrypsin and kallikrein, it has a digestive function in the intestine. Elastase 3B preferentially cleaves proteins after alanine residues. Elastase 3B may also function in the intestinal transport and metabolism of cholesterol. Both elastase 3A and elastase 3B have been referred to as protease E and as elastase 1, and excretion of this protein in fecal material is frequently used as a measure of pancreatic function in clinical assays. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in Cela3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Cela3b APN 4 137423281 missense probably damaging 1.00
IGL00708:Cela3b APN 4 137421969 missense probably benign
IGL01301:Cela3b APN 4 137423843 critical splice donor site probably null
IGL01613:Cela3b APN 4 137425071 missense possibly damaging 0.66
ANU18:Cela3b UTSW 4 137423843 critical splice donor site probably null
R0669:Cela3b UTSW 4 137428530 missense probably benign 0.06
R2937:Cela3b UTSW 4 137423263 missense probably benign 0.01
R2938:Cela3b UTSW 4 137423263 missense probably benign 0.01
R4327:Cela3b UTSW 4 137423931 missense probably benign 0.26
R4451:Cela3b UTSW 4 137421044 utr 3 prime probably benign
R5059:Cela3b UTSW 4 137424870 missense probably benign 0.00
R5707:Cela3b UTSW 4 137424856 missense probably damaging 1.00
X0019:Cela3b UTSW 4 137423310 missense probably damaging 1.00
X0019:Cela3b UTSW 4 137423311 missense probably damaging 1.00
Z1177:Cela3b UTSW 4 137428484 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGCCAGGGGATACTTCTC -3'
(R):5'- TGAAGTCAGAGCCCAACCTTATC -3'

Sequencing Primer
(F):5'- TGGCCAGGGGATACTTCTCAATAC -3'
(R):5'- GTCAGAGCCCAACCTTATCCTCAG -3'
Posted On2020-09-15