Incidental Mutation 'R7952:Zkscan14'
ID649611
Institutional Source Beutler Lab
Gene Symbol Zkscan14
Ensembl Gene ENSMUSG00000029627
Gene Namezinc finger with KRAB and SCAN domains 14
Synonyms2810437E14Rik, 2310046C23Rik, Zfp99
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145194946-145201868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 145195898 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 274 (H274Q)
Ref Sequence ENSEMBL: ENSMUSP00000031632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031632] [ENSMUST00000037056] [ENSMUST00000161741] [ENSMUST00000162220] [ENSMUST00000162360] [ENSMUST00000198959]
Predicted Effect probably damaging
Transcript: ENSMUST00000031632
AA Change: H274Q

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031632
Gene: ENSMUSG00000029627
AA Change: H274Q

DomainStartEndE-ValueType
SCAN 40 152 6.65e-65 SMART
KRAB 135 196 2.79e-13 SMART
low complexity region 258 269 N/A INTRINSIC
ZnF_C2H2 327 349 1.58e-3 SMART
ZnF_C2H2 355 377 4.01e-5 SMART
ZnF_C2H2 383 405 1.04e-3 SMART
ZnF_C2H2 411 432 2.82e0 SMART
ZnF_C2H2 438 460 4.54e-4 SMART
ZnF_C2H2 466 488 1.95e-3 SMART
ZnF_C2H2 494 516 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037056
SMART Domains Protein: ENSMUSP00000039726
Gene: ENSMUSG00000038690

DomainStartEndE-ValueType
Pfam:WRW 1 73 1.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161741
SMART Domains Protein: ENSMUSP00000125504
Gene: ENSMUSG00000038690

DomainStartEndE-ValueType
Pfam:WRW 6 84 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161845
Predicted Effect probably damaging
Transcript: ENSMUST00000162220
AA Change: H140Q

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124196
Gene: ENSMUSG00000029627
AA Change: H140Q

DomainStartEndE-ValueType
KRAB 1 62 2.79e-13 SMART
low complexity region 124 135 N/A INTRINSIC
ZnF_C2H2 193 215 1.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162360
Predicted Effect probably benign
Transcript: ENSMUST00000198959
SMART Domains Protein: ENSMUSP00000143630
Gene: ENSMUSG00000029627

DomainStartEndE-ValueType
SCAN 40 143 4.29e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein that inhibits the transcription of mitogen-activated protein kinase signaling pathways. The encoded protein may be involved in cardiac function. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Other mutations in Zkscan14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Zkscan14 APN 5 145195996 missense probably benign 0.13
IGL02005:Zkscan14 APN 5 145195609 missense probably benign 0.03
R1672:Zkscan14 UTSW 5 145201654 missense probably benign 0.02
R2166:Zkscan14 UTSW 5 145196134 missense probably benign 0.00
R4169:Zkscan14 UTSW 5 145196175 missense possibly damaging 0.55
R4789:Zkscan14 UTSW 5 145195634 missense probably damaging 1.00
R4853:Zkscan14 UTSW 5 145195191 missense probably benign 0.05
R4959:Zkscan14 UTSW 5 145195492 missense probably benign 0.00
R5391:Zkscan14 UTSW 5 145195794 missense probably benign 0.00
R5457:Zkscan14 UTSW 5 145201359 missense probably benign 0.00
R6752:Zkscan14 UTSW 5 145195506 missense probably damaging 1.00
R7619:Zkscan14 UTSW 5 145195359 missense probably benign 0.04
R7736:Zkscan14 UTSW 5 145195509 missense probably benign 0.10
R8005:Zkscan14 UTSW 5 145195758 missense possibly damaging 0.83
R8828:Zkscan14 UTSW 5 145201565 nonsense probably null
R8910:Zkscan14 UTSW 5 145195380 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTTGAAGAGGTCCGAGC -3'
(R):5'- GTCCCAGCACTTACCAAATGTG -3'

Sequencing Primer
(F):5'- GTCTGAAGCCCTTCTCACAG -3'
(R):5'- AAATGTGGTGACCCCTCTGAG -3'
Posted On2020-09-15