Incidental Mutation 'R7952:Chst8'
ID649614
Institutional Source Beutler Lab
Gene Symbol Chst8
Ensembl Gene ENSMUSG00000060402
Gene Namecarbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Synonyms1500011J21Rik, GalNAc4ST-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location34674468-34812711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34675494 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 307 (Y307H)
Ref Sequence ENSEMBL: ENSMUSP00000077752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078686] [ENSMUST00000154629] [ENSMUST00000205259]
Predicted Effect probably damaging
Transcript: ENSMUST00000078686
AA Change: Y307H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077752
Gene: ENSMUSG00000060402
AA Change: Y307H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 98 108 N/A INTRINSIC
Pfam:Sulfotransfer_2 175 410 4.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154629
SMART Domains Protein: ENSMUSP00000123498
Gene: ENSMUSG00000060402

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205259
AA Change: Y307H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfotransferase 2 family. It is predominantly expressed in the pituitary gland, and is localized to the golgi membrane. This protein catalyzes the transfer of sulfate to position 4 of non-reducing N-acetylgalactosamine (GalNAc) residues in both N-glycans and O-glycans. It is responsible for sulfation of GalNAc on luteinizing hormone (LH), which is required for production of the sex hormones. Mice lacking this enzyme, exhibit increased levels of circulating LH, and precocious sexual maturation of both male and female mice. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Male mice homozygous for a null allele show higher luteinizing hormone and testosterone levels, early sexual maturation and enlarged seminal vesicles; females show higher LH, estrogen and progesterone levels, early sexual maturation, enlarged uteri, a prolonged estrous cycle and increased fecundity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in Chst8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02078:Chst8 APN 7 34675334 missense possibly damaging 0.66
R0306:Chst8 UTSW 7 34675298 missense probably benign
R1445:Chst8 UTSW 7 34748168 missense possibly damaging 0.95
R1510:Chst8 UTSW 7 34675268 missense probably benign 0.00
R2022:Chst8 UTSW 7 34675164 missense possibly damaging 0.92
R2248:Chst8 UTSW 7 34748172 missense probably damaging 0.98
R2262:Chst8 UTSW 7 34676010 missense probably benign
R4463:Chst8 UTSW 7 34675220 missense probably damaging 0.98
R4764:Chst8 UTSW 7 34675724 missense probably damaging 0.98
R5379:Chst8 UTSW 7 34675854 missense probably damaging 1.00
R5521:Chst8 UTSW 7 34675245 missense probably benign
R5679:Chst8 UTSW 7 34675304 missense probably damaging 1.00
R6412:Chst8 UTSW 7 34676079 missense probably benign 0.03
R7247:Chst8 UTSW 7 34675936 missense probably damaging 1.00
R7282:Chst8 UTSW 7 34748203 critical splice acceptor site probably null
R8261:Chst8 UTSW 7 34748154 missense possibly damaging 0.94
Z1186:Chst8 UTSW 7 34748181 missense probably damaging 0.98
Z1191:Chst8 UTSW 7 34748181 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGCCTGTCCTTGAACCTC -3'
(R):5'- ATAGTGCACCGCCTCAGTAC -3'

Sequencing Primer
(F):5'- TCCTTGAACCTCGGGAAAGTCAG -3'
(R):5'- CAAGATGCTCTTTGTCCGGGAAC -3'
Posted On2020-09-15