Incidental Mutation 'R7952:Trmt1'
ID649620
Institutional Source Beutler Lab
Gene Symbol Trmt1
Ensembl Gene ENSMUSG00000001909
Gene NametRNA methyltransferase 1
SynonymsD8Ertd812e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R7952 (G1)
Quality Score198.009
Status Validated
Chromosome8
Chromosomal Location84686307-84699808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84689340 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 9 (R9H)
Ref Sequence ENSEMBL: ENSMUSP00000105390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001974] [ENSMUST00000001975] [ENSMUST00000109767] [ENSMUST00000109768] [ENSMUST00000125370] [ENSMUST00000131700] [ENSMUST00000143427] [ENSMUST00000152301] [ENSMUST00000175784] [ENSMUST00000177084] [ENSMUST00000177423] [ENSMUST00000177531]
Predicted Effect probably benign
Transcript: ENSMUST00000001974
SMART Domains Protein: ENSMUSP00000001974
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 499 3.5e-151 PFAM
Pfam:Met_10 141 256 1.3e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001975
SMART Domains Protein: ENSMUSP00000001975
Gene: ENSMUSG00000001910

DomainStartEndE-ValueType
BTB 30 124 4.05e-25 SMART
low complexity region 135 146 N/A INTRINSIC
low complexity region 224 235 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
BEN 382 457 6.4e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109767
SMART Domains Protein: ENSMUSP00000105389
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 499 4.9e-149 PFAM
Pfam:Met_10 142 256 3.4e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109768
AA Change: R9H

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105390
Gene: ENSMUSG00000001909
AA Change: R9H

DomainStartEndE-ValueType
Pfam:TRM 48 492 3.1e-149 PFAM
Pfam:Met_10 135 249 4.4e-8 PFAM
ZnF_C3H1 592 618 3.55e-6 SMART
low complexity region 641 654 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125370
SMART Domains Protein: ENSMUSP00000135510
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 470 1.7e-140 PFAM
Pfam:Met_10 142 256 2.8e-8 PFAM
ZnF_C3H1 570 596 3.55e-6 SMART
low complexity region 619 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131700
SMART Domains Protein: ENSMUSP00000122526
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 108 3.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143427
AA Change: R9H

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117140
Gene: ENSMUSG00000001909
AA Change: R9H

DomainStartEndE-ValueType
Pfam:TRM 47 98 3.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152301
SMART Domains Protein: ENSMUSP00000116712
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 242 4.2e-49 PFAM
Pfam:Met_10 145 229 2.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175784
SMART Domains Protein: ENSMUSP00000135273
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 221 8.6e-39 PFAM
Pfam:Met_10 144 221 5.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177084
SMART Domains Protein: ENSMUSP00000135675
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 29 260 4.1e-76 PFAM
Pfam:Met_10 117 231 4.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177423
AA Change: R9H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135327
Gene: ENSMUSG00000001909
AA Change: R9H

DomainStartEndE-ValueType
Pfam:TRM 47 262 1.4e-66 PFAM
Pfam:Met_10 138 252 5.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177531
SMART Domains Protein: ENSMUSP00000135540
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 174 1.8e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in Trmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Trmt1 APN 8 84695509 missense possibly damaging 0.92
IGL01959:Trmt1 APN 8 84691376 splice site probably null
IGL02127:Trmt1 APN 8 84697471 missense probably damaging 1.00
IGL02689:Trmt1 APN 8 84699756 unclassified probably benign
IGL03087:Trmt1 APN 8 84695233 missense probably damaging 1.00
IGL02835:Trmt1 UTSW 8 84696960 missense probably null 1.00
PIT4418001:Trmt1 UTSW 8 84697670 missense probably damaging 0.97
R0395:Trmt1 UTSW 8 84697112 splice site probably null
R0964:Trmt1 UTSW 8 84696852 missense probably damaging 1.00
R1881:Trmt1 UTSW 8 84689267 intron probably benign
R2190:Trmt1 UTSW 8 84689841 nonsense probably null
R2197:Trmt1 UTSW 8 84690858 missense probably damaging 1.00
R2979:Trmt1 UTSW 8 84696882 missense probably damaging 1.00
R3813:Trmt1 UTSW 8 84695217 unclassified probably benign
R4407:Trmt1 UTSW 8 84697755 unclassified probably benign
R4461:Trmt1 UTSW 8 84699149 missense probably benign 0.01
R4588:Trmt1 UTSW 8 84690753 intron probably benign
R5170:Trmt1 UTSW 8 84695232 missense probably damaging 1.00
R6299:Trmt1 UTSW 8 84697290 nonsense probably null
R6614:Trmt1 UTSW 8 84689333 missense probably benign
R6666:Trmt1 UTSW 8 84698454 missense probably damaging 1.00
R7669:Trmt1 UTSW 8 84697551 missense probably benign 0.05
Z1176:Trmt1 UTSW 8 84698240 missense possibly damaging 0.95
Z1176:Trmt1 UTSW 8 84699198 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTGAAACTCCCTTGTAGAAGAG -3'
(R):5'- GTGGCCTCCATAACATCCTG -3'

Sequencing Primer
(F):5'- AGAAGAGTCTTGACCCTG -3'
(R):5'- ATAACATCCTGCGTTCTCGAGGG -3'
Posted On2020-09-15