Incidental Mutation 'R7952:Bphl'
ID649628
Institutional Source Beutler Lab
Gene Symbol Bphl
Ensembl Gene ENSMUSG00000038286
Gene Namebiphenyl hydrolase-like (serine hydrolase, breast epithelial mucin-associated antigen)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location34037597-34074074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34046797 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 75 (T75A)
Ref Sequence ENSEMBL: ENSMUSP00000046168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040656] [ENSMUST00000222658] [ENSMUST00000222691]
Predicted Effect probably benign
Transcript: ENSMUST00000040656
AA Change: T75A

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000046168
Gene: ENSMUSG00000038286
AA Change: T75A

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Pfam:Hydrolase_4 57 208 1.1e-10 PFAM
Pfam:Abhydrolase_1 61 205 2.8e-22 PFAM
Pfam:Abhydrolase_5 62 273 3.9e-20 PFAM
Pfam:Abhydrolase_6 63 285 6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222658
Predicted Effect silent
Transcript: ENSMUST00000222691
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine protease family of hydrolytic enzymes which contain a serine in their active site. The encoded protein may play a role in activation of the antiviral prodrug valacyclovir. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in Bphl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Bphl APN 13 34063997 missense probably damaging 1.00
IGL03087:Bphl APN 13 34073711 missense probably damaging 1.00
R0127:Bphl UTSW 13 34064046 unclassified probably benign
R0494:Bphl UTSW 13 34037771 makesense probably null
R1475:Bphl UTSW 13 34060524 missense probably benign
R5862:Bphl UTSW 13 34063984 missense possibly damaging 0.87
R6849:Bphl UTSW 13 34050269 splice site probably null
R7325:Bphl UTSW 13 34050341 missense possibly damaging 0.49
R7528:Bphl UTSW 13 34060490 missense probably damaging 1.00
R8497:Bphl UTSW 13 34037723 missense possibly damaging 0.53
R8790:Bphl UTSW 13 34060485 missense probably benign 0.01
R8907:Bphl UTSW 13 34046947 missense not run
X0009:Bphl UTSW 13 34037763 missense probably benign 0.06
X0010:Bphl UTSW 13 34037763 missense probably benign 0.06
X0011:Bphl UTSW 13 34037763 missense probably benign 0.06
X0014:Bphl UTSW 13 34037763 missense probably benign 0.06
X0017:Bphl UTSW 13 34037763 missense probably benign 0.06
X0021:Bphl UTSW 13 34037763 missense probably benign 0.06
X0023:Bphl UTSW 13 34037763 missense probably benign 0.06
X0033:Bphl UTSW 13 34037763 missense probably benign 0.06
X0064:Bphl UTSW 13 34037763 missense probably benign 0.06
X0067:Bphl UTSW 13 34037763 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCCATCAGGCTTGGCAATGC -3'
(R):5'- TAAAGATGGGCCCAGTCATCTCTC -3'

Sequencing Primer
(F):5'- CTCTGTGTGGAGCCATTGCAAC -3'
(R):5'- AGTCATCTCTCCCCACTCCAG -3'
Posted On2020-09-15