Incidental Mutation 'R7952:Rec8'
ID649632
Institutional Source Beutler Lab
Gene Symbol Rec8
Ensembl Gene ENSMUSG00000002324
Gene NameREC8 meiotic recombination protein
Synonymsmrec, Rec8L1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55618037-55625395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55625303 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 573 (V573A)
Ref Sequence ENSEMBL: ENSMUSP00000002395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002395] [ENSMUST00000047131] [ENSMUST00000135221] [ENSMUST00000141499] [ENSMUST00000148351]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002395
AA Change: V573A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002395
Gene: ENSMUSG00000002324
AA Change: V573A

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 117 2.2e-26 PFAM
low complexity region 235 249 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
Pfam:Rad21_Rec8 536 590 9.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141499
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156420
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kleisin family of SMC (structural maintenance of chromosome) protein partners. The protein localizes to the axial elements of chromosomes during meiosis in both oocytes and spermatocytes. In the mouse, the homologous protein is a key component of the meiotic cohesion complex, which regulates sister chromatid cohesion and recombination between homologous chromosomes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are infertile and exhibit small ovaries and testes. Females show absence of ovarian follicles and abnormal meiosis, while males exhibit abnormal chromosome pairing during meiosis, abnormal synaptonemal complex formation, and arrest of male meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in Rec8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Rec8 APN 14 55623515 nonsense probably null
IGL00427:Rec8 APN 14 55618651 missense probably damaging 1.00
IGL02116:Rec8 APN 14 55624879 splice site probably null
R1349:Rec8 UTSW 14 55618974 missense probably damaging 1.00
R1372:Rec8 UTSW 14 55618974 missense probably damaging 1.00
R1564:Rec8 UTSW 14 55622275 splice site probably null
R1667:Rec8 UTSW 14 55618796 missense probably damaging 1.00
R1970:Rec8 UTSW 14 55624142 missense probably damaging 1.00
R3157:Rec8 UTSW 14 55625306 missense probably damaging 0.96
R3625:Rec8 UTSW 14 55622497 missense possibly damaging 0.94
R3919:Rec8 UTSW 14 55621259 missense probably benign 0.02
R4280:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4282:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4283:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4622:Rec8 UTSW 14 55624758 missense probably damaging 1.00
R4894:Rec8 UTSW 14 55625330 missense probably damaging 1.00
R5488:Rec8 UTSW 14 55622826 missense probably benign 0.00
R5489:Rec8 UTSW 14 55622826 missense probably benign 0.00
R6113:Rec8 UTSW 14 55622478 missense probably damaging 0.99
R6264:Rec8 UTSW 14 55619179 missense probably damaging 1.00
R6439:Rec8 UTSW 14 55618619 missense possibly damaging 0.50
Z1088:Rec8 UTSW 14 55625147 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAACAAGGAGCTGGACTTC -3'
(R):5'- TGAGCTCCAGAGGTTTAATTCCC -3'

Sequencing Primer
(F):5'- TGGACTTCAGCAGCCTGGTG -3'
(R):5'- AATGAACTTGCTCAGGGG -3'
Posted On2020-09-15