Incidental Mutation 'R7952:Mroh2b'
ID649634
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4951211 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1421 (F1421L)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: F1421L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: F1421L

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAAGAGTCCTTGGAATGCAG -3'
(R):5'- GCTAAAGGGTGACTTCTGGC -3'

Sequencing Primer
(F):5'- TATACCAGTGCTCAGATGCCAG -3'
(R):5'- CCTAGTTTTTGATTCAGAGAGAGAAG -3'
Posted On2020-09-15