Incidental Mutation 'R7952:Fmnl3'
ID649636
Institutional Source Beutler Lab
Gene Symbol Fmnl3
Ensembl Gene ENSMUSG00000023008
Gene Nameformin-like 3
SynonymsWbp3, 2700073B04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_011711; MGI: 109569  

Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99317225-99370482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99322637 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 588 (V588A)
Ref Sequence ENSEMBL: ENSMUSP00000085566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000120633]
Predicted Effect probably benign
Transcript: ENSMUST00000081224
AA Change: V537A

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008
AA Change: V537A

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088233
AA Change: V588A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008
AA Change: V588A

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120633
AA Change: V588A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008
AA Change: V588A

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a formin homology 2 domain and has high sequence identity to the mouse Wbp3 protein. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in Fmnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00672:Fmnl3 APN 15 99325681 missense probably damaging 1.00
IGL00727:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00754:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00927:Fmnl3 APN 15 99337628 critical splice donor site probably null
IGL02376:Fmnl3 APN 15 99318963 missense possibly damaging 0.51
IGL02607:Fmnl3 APN 15 99324772 missense probably damaging 1.00
IGL03323:Fmnl3 APN 15 99321281 missense probably damaging 1.00
C9142:Fmnl3 UTSW 15 99337627 splice site probably null
PIT4280001:Fmnl3 UTSW 15 99321253 critical splice donor site probably null
R0003:Fmnl3 UTSW 15 99321132 missense probably damaging 0.99
R0003:Fmnl3 UTSW 15 99321132 missense probably damaging 0.99
R0116:Fmnl3 UTSW 15 99322738 splice site probably benign
R0117:Fmnl3 UTSW 15 99322738 splice site probably benign
R0137:Fmnl3 UTSW 15 99322738 splice site probably benign
R0138:Fmnl3 UTSW 15 99322738 splice site probably benign
R0701:Fmnl3 UTSW 15 99321307 missense probably damaging 0.99
R2338:Fmnl3 UTSW 15 99370227 missense probably benign 0.01
R3729:Fmnl3 UTSW 15 99321864 missense probably damaging 0.99
R4707:Fmnl3 UTSW 15 99323481 missense probably benign 0.00
R5346:Fmnl3 UTSW 15 99331990 missense probably damaging 1.00
R5655:Fmnl3 UTSW 15 99321862 missense probably damaging 0.99
R5916:Fmnl3 UTSW 15 99321828 missense probably damaging 0.99
R5951:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R5954:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R5957:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R6334:Fmnl3 UTSW 15 99337653 missense probably damaging 1.00
R6891:Fmnl3 UTSW 15 99325873 missense probably damaging 1.00
R7182:Fmnl3 UTSW 15 99321782 missense probably damaging 0.99
R7423:Fmnl3 UTSW 15 99329400 missense probably damaging 0.99
R7977:Fmnl3 UTSW 15 99328098 missense possibly damaging 0.89
R7987:Fmnl3 UTSW 15 99328098 missense possibly damaging 0.89
R8749:Fmnl3 UTSW 15 99321441 missense possibly damaging 0.88
X0009:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0010:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0011:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0012:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0014:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0017:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0021:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99325284 missense probably damaging 1.00
X0028:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0033:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0060:Fmnl3 UTSW 15 99320038 missense possibly damaging 0.69
X0064:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0067:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCAGTCGTGACTAGATAATGG -3'
(R):5'- TCTTCCCAGACAAGTGTCCC -3'

Sequencing Primer
(F):5'- ACTAGATAATGGGGTCAGTCTTGCTC -3'
(R):5'- CCTGTCAGGTGAGTGTCCTC -3'
Posted On2020-09-15