Incidental Mutation 'R7952:Cxadr'
ID649637
Institutional Source Beutler Lab
Gene Symbol Cxadr
Ensembl Gene ENSMUSG00000022865
Gene Namecoxsackie virus and adenovirus receptor
SynonymsMCAR, MCVADR, 2610206D03Rik, CAR
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location78301489-78359774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78334235 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 213 (T213M)
Ref Sequence ENSEMBL: ENSMUSP00000023572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023572] [ENSMUST00000114229] [ENSMUST00000231353] [ENSMUST00000231356]
PDB Structure Crystal structure of the extracellular domains of coxsackie & adenovirus receptor from mouse (mCAR) [X-RAY DIFFRACTION]
Crystal structure of the complex of JAML and Coxsackie and Adenovirus receptor, CAR [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023572
AA Change: T213M

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023572
Gene: ENSMUSG00000022865
AA Change: T213M

DomainStartEndE-ValueType
IG 26 138 1.99e-7 SMART
IGc2 153 219 7.7e-5 SMART
low complexity region 262 272 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114229
AA Change: T213M

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109867
Gene: ENSMUSG00000022865
AA Change: T213M

DomainStartEndE-ValueType
IG 26 138 1.99e-7 SMART
IGc2 153 219 7.7e-5 SMART
low complexity region 262 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231251
Predicted Effect probably benign
Transcript: ENSMUST00000231353
Predicted Effect probably benign
Transcript: ENSMUST00000231356
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: This gene encodes a protein that is part of the Cortical Thymocyte marker in Xenopus (CTX) subfamily within the immunoglobulin superfamily. Members of this subfamily, predominantly expressed on the surface of endothelial and epithelial cells, help establish cell polarity and provide a barrier function, regulating migration of immune cells. This protein, first identified as the receptor for adenovirus subgroup C and coxsakieviruses group B, is developmentally regulated and plays an important role in cardiac development. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with focal cardiomyocyte apoptosis and extensive thoracic hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
D3Ertd751e T A 3: 41,748,661 probably null Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in Cxadr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Cxadr APN 16 78334227 nonsense probably null
R0309:Cxadr UTSW 16 78334948 missense probably benign 0.00
R1129:Cxadr UTSW 16 78336433 missense probably benign 0.27
R1142:Cxadr UTSW 16 78334839 missense probably benign 0.04
R1713:Cxadr UTSW 16 78334245 missense probably damaging 1.00
R6432:Cxadr UTSW 16 78325259 missense probably damaging 1.00
R6637:Cxadr UTSW 16 78333503 missense possibly damaging 0.47
R7597:Cxadr UTSW 16 78329108 missense probably damaging 1.00
R7735:Cxadr UTSW 16 78329061 missense possibly damaging 0.92
R7809:Cxadr UTSW 16 78333519 critical splice donor site probably null
R8073:Cxadr UTSW 16 78333413 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGAATTCTGGACATGCGCGTC -3'
(R):5'- TCCCCATGTGAGCATCCTTG -3'

Sequencing Primer
(F):5'- AGTTTGTCTGCACCCAGC -3'
(R):5'- TTGCCGTCACAGACTCTCACAG -3'
Posted On2020-09-15