Incidental Mutation 'R7953:Strc'
ID649649
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
MMRRC Submission
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R7953 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121377363 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 509 (F509Y)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
Predicted Effect probably damaging
Transcript: ENSMUST00000038389
AA Change: F509Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: F509Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Meta Mutation Damage Score 0.1330 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A G 4: 62,532,659 R120G probably null Het
Abcb9 T C 5: 124,073,602 Y628C probably damaging Het
Alpk2 C T 18: 65,349,830 C369Y probably damaging Het
Caskin1 T G 17: 24,504,221 L661R probably damaging Het
Cep83 A C 10: 94,737,942 N231T probably damaging Het
Cfap44 G A 16: 44,413,691 G338D probably benign Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Col4a4 A G 1: 82,453,968 S1532P unknown Het
Cplx4 A T 18: 65,957,119 probably null Het
Csf1r G C 18: 61,124,875 G639R probably damaging Het
Dnajc27 T C 12: 4,097,270 L151P possibly damaging Het
Epha5 A G 5: 84,233,654 V446A probably benign Het
Esam T C 9: 37,537,021 V252A probably damaging Het
Flnc C A 6: 29,447,829 D1210E probably damaging Het
Fmn1 G A 2: 113,596,344 M1233I probably benign Het
Fstl4 T C 11: 53,000,223 S63P probably benign Het
Gas2l2 A G 11: 83,423,244 V414A possibly damaging Het
Glra1 G A 11: 55,533,862 P174L probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm16485 A T 9: 8,972,195 N21Y unknown Het
Gm9774 A T 3: 92,429,330 Y22N probably benign Het
Golga7 A T 8: 23,256,715 C24S possibly damaging Het
Ints8 T C 4: 11,227,128 T582A probably benign Het
Irx2 A T 13: 72,629,224 T55S probably benign Het
Lce1j A T 3: 92,789,083 C129* probably null Het
Mocs1 G A 17: 49,454,771 G631E possibly damaging Het
Mpi A T 9: 57,550,598 L107Q probably damaging Het
Msrb2 A G 2: 19,394,355 *176W probably null Het
Myh13 T A 11: 67,340,380 L401Q probably damaging Het
Npffr2 G A 5: 89,582,654 V148I probably benign Het
Oas1a T C 5: 120,897,017 E360G probably benign Het
Olfr1016 A T 2: 85,799,895 I125N probably damaging Het
Olfr1446 A C 19: 12,889,731 V282G probably damaging Het
Olfr726 A T 14: 50,083,910 I257N possibly damaging Het
Pcdha2 A G 18: 36,939,526 D70G probably benign Het
Phf11b T C 14: 59,331,273 S64G probably benign Het
Plpp2 A C 10: 79,530,540 L146R possibly damaging Het
Poc5 T A 13: 96,402,900 N316K probably benign Het
Rad51ap2 A T 12: 11,462,592 R947* probably null Het
Ralgapb A G 2: 158,465,883 H1037R probably benign Het
Rpl21 T C 5: 146,835,892 V141A probably benign Het
Rrnad1 T C 3: 87,927,648 N115S possibly damaging Het
Rufy3 C A 5: 88,642,992 D517E probably benign Het
Scn7a A G 2: 66,757,326 V11A possibly damaging Het
Sipa1l1 A C 12: 82,449,926 Q1744P probably damaging Het
Smc2 T C 4: 52,470,911 probably null Het
Sorcs3 T A 19: 48,764,295 L843Q possibly damaging Het
Tas2r117 A C 6: 132,803,318 T140P probably damaging Het
Tnxb T A 17: 34,709,535 I2641N possibly damaging Het
Tnxb C A 17: 34,710,103 P2707T probably benign Het
Vmn1r4 T A 6: 56,956,530 N6K probably benign Het
Vmn1r91 T A 7: 20,101,293 S46T possibly damaging Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 splice site probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
R8137:Strc UTSW 2 121366738 missense probably damaging 0.98
R8394:Strc UTSW 2 121379009 missense probably benign 0.00
R8427:Strc UTSW 2 121377531 missense probably damaging 1.00
Z1176:Strc UTSW 2 121375521 missense probably damaging 0.98
Z1176:Strc UTSW 2 121379044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGAGTGTCATTGGCACAG -3'
(R):5'- GCCTGCCATGATCAGTTTCC -3'

Sequencing Primer
(F):5'- TGTCATTGGCACAGACCATG -3'
(R):5'- CTGATCAATTTCTGGATATGATCTGC -3'
Posted On2020-09-15