Mutagenetix > Incidental Mutation

Incidental Mutation 'R7953:Strc'

649649

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

045997-MU

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R7953 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121377363 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 509 (F509Y)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably damaging
Transcript: ENSMUST00000038389
AA Change: F509Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: F509Y

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Meta Mutation Damage Score

0.1330

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	A	G	4: 62,532,659	R120G	probably null	Het
Abcb9	T	C	5: 124,073,602	Y628C	probably damaging	Het
Alpk2	C	T	18: 65,349,830	C369Y	probably damaging	Het
Caskin1	T	G	17: 24,504,221	L661R	probably damaging	Het
Cep83	A	C	10: 94,737,942	N231T	probably damaging	Het
Cfap44	G	A	16: 44,413,691	G338D	probably benign	Het
Chrna7	T	G	7: 63,103,793	K326T	possibly damaging	Het
Col4a4	A	G	1: 82,453,968	S1532P	unknown	Het
Cplx4	A	T	18: 65,957,119		probably null	Het
Csf1r	G	C	18: 61,124,875	G639R	probably damaging	Het
Dnajc27	T	C	12: 4,097,270	L151P	possibly damaging	Het
Epha5	A	G	5: 84,233,654	V446A	probably benign	Het
Esam	T	C	9: 37,537,021	V252A	probably damaging	Het
Flnc	C	A	6: 29,447,829	D1210E	probably damaging	Het
Fmn1	G	A	2: 113,596,344	M1233I	probably benign	Het
Fstl4	T	C	11: 53,000,223	S63P	probably benign	Het
Gas2l2	A	G	11: 83,423,244	V414A	possibly damaging	Het
Glra1	G	A	11: 55,533,862	P174L	probably damaging	Het
Gm15922	C	G	7: 3,737,320	A301P	probably damaging	Het
Gm16485	A	T	9: 8,972,195	N21Y	unknown	Het
Gm9774	A	T	3: 92,429,330	Y22N	probably benign	Het
Golga7	A	T	8: 23,256,715	C24S	possibly damaging	Het
Ints8	T	C	4: 11,227,128	T582A	probably benign	Het
Irx2	A	T	13: 72,629,224	T55S	probably benign	Het
Lce1j	A	T	3: 92,789,083	C129*	probably null	Het
Mocs1	G	A	17: 49,454,771	G631E	possibly damaging	Het
Mpi	A	T	9: 57,550,598	L107Q	probably damaging	Het
Msrb2	A	G	2: 19,394,355	*176W	probably null	Het
Myh13	T	A	11: 67,340,380	L401Q	probably damaging	Het
Npffr2	G	A	5: 89,582,654	V148I	probably benign	Het
Oas1a	T	C	5: 120,897,017	E360G	probably benign	Het
Olfr1016	A	T	2: 85,799,895	I125N	probably damaging	Het
Olfr1446	A	C	19: 12,889,731	V282G	probably damaging	Het
Olfr726	A	T	14: 50,083,910	I257N	possibly damaging	Het
Pcdha2	A	G	18: 36,939,526	D70G	probably benign	Het
Phf11b	T	C	14: 59,331,273	S64G	probably benign	Het
Plpp2	A	C	10: 79,530,540	L146R	possibly damaging	Het
Poc5	T	A	13: 96,402,900	N316K	probably benign	Het
Rad51ap2	A	T	12: 11,462,592	R947*	probably null	Het
Ralgapb	A	G	2: 158,465,883	H1037R	probably benign	Het
Rpl21	T	C	5: 146,835,892	V141A	probably benign	Het
Rrnad1	T	C	3: 87,927,648	N115S	possibly damaging	Het
Rufy3	C	A	5: 88,642,992	D517E	probably benign	Het
Scn7a	A	G	2: 66,757,326	V11A	possibly damaging	Het
Sipa1l1	A	C	12: 82,449,926	Q1744P	probably damaging	Het
Smc2	T	C	4: 52,470,911		probably null	Het
Sorcs3	T	A	19: 48,764,295	L843Q	possibly damaging	Het
Tas2r117	A	C	6: 132,803,318	T140P	probably damaging	Het
Tnxb	T	A	17: 34,709,535	I2641N	possibly damaging	Het
Tnxb	C	A	17: 34,710,103	P2707T	probably benign	Het
Vmn1r4	T	A	6: 56,956,530	N6K	probably benign	Het
Vmn1r91	T	A	7: 20,101,293	S46T	possibly damaging	Het
Zfp750	T	C	11: 121,511,880	T681A	probably benign	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACAGAGTGTCATTGGCACAG -3'
(R):5'- GCCTGCCATGATCAGTTTCC -3'

Sequencing Primer
(F):5'- TGTCATTGGCACAGACCATG -3'
(R):5'- CTGATCAATTTCTGGATATGATCTGC -3'

Posted On

2020-09-15