Incidental Mutation 'R7953:4933430I17Rik'
ID649656
Institutional Source Beutler Lab
Gene Symbol 4933430I17Rik
Ensembl Gene ENSMUSG00000058046
Gene NameRIKEN cDNA 4933430I17 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7953 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location62525369-62547993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62532659 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 120 (R120G)
Ref Sequence ENSEMBL: ENSMUSP00000050465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062145]
Predicted Effect probably null
Transcript: ENSMUST00000062145
AA Change: R120G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050465
Gene: ENSMUSG00000058046
AA Change: R120G

DomainStartEndE-ValueType
Pfam:DUF4647 22 481 7.3e-182 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,073,602 Y628C probably damaging Het
Alpk2 C T 18: 65,349,830 C369Y probably damaging Het
Caskin1 T G 17: 24,504,221 L661R probably damaging Het
Cep83 A C 10: 94,737,942 N231T probably damaging Het
Cfap44 G A 16: 44,413,691 G338D probably benign Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Col4a4 A G 1: 82,453,968 S1532P unknown Het
Cplx4 A T 18: 65,957,119 probably null Het
Csf1r G C 18: 61,124,875 G639R probably damaging Het
Dnajc27 T C 12: 4,097,270 L151P possibly damaging Het
Epha5 A G 5: 84,233,654 V446A probably benign Het
Esam T C 9: 37,537,021 V252A probably damaging Het
Flnc C A 6: 29,447,829 D1210E probably damaging Het
Fmn1 G A 2: 113,596,344 M1233I probably benign Het
Fstl4 T C 11: 53,000,223 S63P probably benign Het
Gas2l2 A G 11: 83,423,244 V414A possibly damaging Het
Glra1 G A 11: 55,533,862 P174L probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm16485 A T 9: 8,972,195 N21Y unknown Het
Gm9774 A T 3: 92,429,330 Y22N probably benign Het
Golga7 A T 8: 23,256,715 C24S possibly damaging Het
Ints8 T C 4: 11,227,128 T582A probably benign Het
Irx2 A T 13: 72,629,224 T55S probably benign Het
Lce1j A T 3: 92,789,083 C129* probably null Het
Mocs1 G A 17: 49,454,771 G631E possibly damaging Het
Mpi A T 9: 57,550,598 L107Q probably damaging Het
Msrb2 A G 2: 19,394,355 *176W probably null Het
Myh13 T A 11: 67,340,380 L401Q probably damaging Het
Npffr2 G A 5: 89,582,654 V148I probably benign Het
Oas1a T C 5: 120,897,017 E360G probably benign Het
Olfr1016 A T 2: 85,799,895 I125N probably damaging Het
Olfr1446 A C 19: 12,889,731 V282G probably damaging Het
Olfr726 A T 14: 50,083,910 I257N possibly damaging Het
Pcdha2 A G 18: 36,939,526 D70G probably benign Het
Phf11b T C 14: 59,331,273 S64G probably benign Het
Plpp2 A C 10: 79,530,540 L146R possibly damaging Het
Poc5 T A 13: 96,402,900 N316K probably benign Het
Rad51ap2 A T 12: 11,462,592 R947* probably null Het
Ralgapb A G 2: 158,465,883 H1037R probably benign Het
Rpl21 T C 5: 146,835,892 V141A probably benign Het
Rrnad1 T C 3: 87,927,648 N115S possibly damaging Het
Rufy3 C A 5: 88,642,992 D517E probably benign Het
Scn7a A G 2: 66,757,326 V11A possibly damaging Het
Sipa1l1 A C 12: 82,449,926 Q1744P probably damaging Het
Smc2 T C 4: 52,470,911 probably null Het
Sorcs3 T A 19: 48,764,295 L843Q possibly damaging Het
Strc A T 2: 121,377,363 F509Y probably damaging Het
Tas2r117 A C 6: 132,803,318 T140P probably damaging Het
Tnxb T A 17: 34,709,535 I2641N possibly damaging Het
Tnxb C A 17: 34,710,103 P2707T probably benign Het
Vmn1r4 T A 6: 56,956,530 N6K probably benign Het
Vmn1r91 T A 7: 20,101,293 S46T possibly damaging Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in 4933430I17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:4933430I17Rik APN 4 62532666 splice site probably benign
IGL00326:4933430I17Rik APN 4 62543744 splice site probably null
IGL01526:4933430I17Rik APN 4 62532621 missense possibly damaging 0.71
IGL02152:4933430I17Rik APN 4 62542754 missense possibly damaging 0.93
IGL03153:4933430I17Rik APN 4 62547326 missense possibly damaging 0.85
R0281:4933430I17Rik UTSW 4 62546067 nonsense probably null
R0436:4933430I17Rik UTSW 4 62543445 splice site probably benign
R1459:4933430I17Rik UTSW 4 62532341 missense probably damaging 0.99
R1807:4933430I17Rik UTSW 4 62542756 nonsense probably null
R1930:4933430I17Rik UTSW 4 62532282 missense possibly damaging 0.83
R1958:4933430I17Rik UTSW 4 62538909 missense probably benign 0.09
R2118:4933430I17Rik UTSW 4 62538872 missense possibly damaging 0.93
R2119:4933430I17Rik UTSW 4 62538872 missense possibly damaging 0.93
R2124:4933430I17Rik UTSW 4 62538872 missense possibly damaging 0.93
R4323:4933430I17Rik UTSW 4 62547311 missense probably damaging 0.98
R4592:4933430I17Rik UTSW 4 62538927 missense possibly damaging 0.93
R5708:4933430I17Rik UTSW 4 62525869 missense probably benign 0.01
R6576:4933430I17Rik UTSW 4 62532605 missense possibly damaging 0.71
R7506:4933430I17Rik UTSW 4 62532261 missense possibly damaging 0.51
R8329:4933430I17Rik UTSW 4 62543741 critical splice donor site probably null
R8348:4933430I17Rik UTSW 4 62542785 critical splice donor site probably null
R8448:4933430I17Rik UTSW 4 62542785 critical splice donor site probably null
R8699:4933430I17Rik UTSW 4 62532278 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTCCAAGCAGCAGGTTAC -3'
(R):5'- TGGAACACTTGTTGGCAGTTTC -3'

Sequencing Primer
(F):5'- CATCACGGATACCTGCTT -3'
(R):5'- CCACTGACTTAATTTTGGATAGGTTC -3'
Posted On2020-09-15