Incidental Mutation 'R7953:Vmn1r91'
ID649667
Institutional Source Beutler Lab
Gene Symbol Vmn1r91
Ensembl Gene ENSMUSG00000095201
Gene Namevomeronasal 1 receptor 91
SynonymsGm8442
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7953 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location20101158-20102081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20101293 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 46 (S46T)
Ref Sequence ENSEMBL: ENSMUSP00000129283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165330]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165330
AA Change: S46T

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129283
Gene: ENSMUSG00000095201
AA Change: S46T

DomainStartEndE-ValueType
Pfam:TAS2R 8 299 5.1e-18 PFAM
Pfam:V1R 41 298 7.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A G 4: 62,532,659 R120G probably null Het
Abcb9 T C 5: 124,073,602 Y628C probably damaging Het
Alpk2 C T 18: 65,349,830 C369Y probably damaging Het
Caskin1 T G 17: 24,504,221 L661R probably damaging Het
Cep83 A C 10: 94,737,942 N231T probably damaging Het
Cfap44 G A 16: 44,413,691 G338D probably benign Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Col4a4 A G 1: 82,453,968 S1532P unknown Het
Csf1r G C 18: 61,124,875 G639R probably damaging Het
Dnajc27 T C 12: 4,097,270 L151P possibly damaging Het
Epha5 A G 5: 84,233,654 V446A probably benign Het
Esam T C 9: 37,537,021 V252A probably damaging Het
Flnc C A 6: 29,447,829 D1210E probably damaging Het
Fmn1 G A 2: 113,596,344 M1233I probably benign Het
Fstl4 T C 11: 53,000,223 S63P probably benign Het
Gas2l2 A G 11: 83,423,244 V414A possibly damaging Het
Glra1 G A 11: 55,533,862 P174L probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm16485 A T 9: 8,972,195 N21Y unknown Het
Gm9774 A T 3: 92,429,330 Y22N probably benign Het
Golga7 A T 8: 23,256,715 C24S possibly damaging Het
Ints8 T C 4: 11,227,128 T582A probably benign Het
Irx2 A T 13: 72,629,224 T55S probably benign Het
Lce1j A T 3: 92,789,083 C129* probably null Het
Mocs1 G A 17: 49,454,771 G631E possibly damaging Het
Mpi A T 9: 57,550,598 L107Q probably damaging Het
Msrb2 A G 2: 19,394,355 *176W probably null Het
Myh13 T A 11: 67,340,380 L401Q probably damaging Het
Npffr2 G A 5: 89,582,654 V148I probably benign Het
Oas1a T C 5: 120,897,017 E360G probably benign Het
Olfr1016 A T 2: 85,799,895 I125N probably damaging Het
Olfr1446 A C 19: 12,889,731 V282G probably damaging Het
Olfr726 A T 14: 50,083,910 I257N possibly damaging Het
Pcdha2 A G 18: 36,939,526 D70G probably benign Het
Phf11b T C 14: 59,331,273 S64G probably benign Het
Plpp2 A C 10: 79,530,540 L146R possibly damaging Het
Poc5 T A 13: 96,402,900 N316K probably benign Het
Rad51ap2 A T 12: 11,462,592 R947* probably null Het
Ralgapb A G 2: 158,465,883 H1037R probably benign Het
Rpl21 T C 5: 146,835,892 V141A probably benign Het
Rrnad1 T C 3: 87,927,648 N115S possibly damaging Het
Rufy3 C A 5: 88,642,992 D517E probably benign Het
Scn7a A G 2: 66,757,326 V11A possibly damaging Het
Sipa1l1 A C 12: 82,449,926 Q1744P probably damaging Het
Smc2 T C 4: 52,470,911 probably null Het
Sorcs3 T A 19: 48,764,295 L843Q possibly damaging Het
Strc A T 2: 121,377,363 F509Y probably damaging Het
Tas2r117 A C 6: 132,803,318 T140P probably damaging Het
Tnxb T A 17: 34,709,535 I2641N possibly damaging Het
Tnxb C A 17: 34,710,103 P2707T probably benign Het
Vmn1r4 T A 6: 56,956,530 N6K probably benign Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Vmn1r91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Vmn1r91 APN 7 20101934 nonsense probably null
IGL02125:Vmn1r91 APN 7 20101504 missense probably damaging 0.96
IGL02263:Vmn1r91 APN 7 20101843 missense probably benign 0.00
IGL02338:Vmn1r91 APN 7 20101746 missense probably damaging 0.96
IGL02708:Vmn1r91 APN 7 20101490 missense probably damaging 1.00
R1880:Vmn1r91 UTSW 7 20101773 missense probably damaging 1.00
R2679:Vmn1r91 UTSW 7 20102058 missense probably damaging 0.97
R4730:Vmn1r91 UTSW 7 20101770 missense possibly damaging 0.71
R5362:Vmn1r91 UTSW 7 20101461 missense probably benign 0.05
R5633:Vmn1r91 UTSW 7 20101945 missense possibly damaging 0.56
R5979:Vmn1r91 UTSW 7 20102065 missense probably benign 0.00
R6151:Vmn1r91 UTSW 7 20101435 missense probably benign
R6177:Vmn1r91 UTSW 7 20101479 missense possibly damaging 0.95
R7397:Vmn1r91 UTSW 7 20101770 missense possibly damaging 0.71
R7589:Vmn1r91 UTSW 7 20101877 missense probably benign 0.07
R7872:Vmn1r91 UTSW 7 20101914 missense probably benign 0.26
R7886:Vmn1r91 UTSW 7 20101565 missense probably benign
R7903:Vmn1r91 UTSW 7 20101210 missense possibly damaging 0.88
R8043:Vmn1r91 UTSW 7 20101293 missense possibly damaging 0.68
R8202:Vmn1r91 UTSW 7 20101824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGAGTAGTGTCCGACCTAATC -3'
(R):5'- ACAAACTGATGGACACTCAGG -3'

Sequencing Primer
(F):5'- GACCTAATCATCACTCCAGGGTTG -3'
(R):5'- CTGATGGACACTCAGGACACAG -3'
Posted On2020-09-15