Incidental Mutation 'R7953:Poc5'
ID649684
Institutional Source Beutler Lab
Gene Symbol Poc5
Ensembl Gene ENSMUSG00000021671
Gene NamePOC5 centriolar protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7953 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location96388294-96417737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96402900 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 316 (N316K)
Ref Sequence ENSEMBL: ENSMUSP00000096898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099295]
Predicted Effect probably benign
Transcript: ENSMUST00000099295
AA Change: N316K

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096898
Gene: ENSMUSG00000021671
AA Change: N316K

DomainStartEndE-ValueType
coiled coil region 175 206 N/A INTRINSIC
coiled coil region 300 341 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A G 4: 62,532,659 R120G probably null Het
Abcb9 T C 5: 124,073,602 Y628C probably damaging Het
Alpk2 C T 18: 65,349,830 C369Y probably damaging Het
Caskin1 T G 17: 24,504,221 L661R probably damaging Het
Cep83 A C 10: 94,737,942 N231T probably damaging Het
Cfap44 G A 16: 44,413,691 G338D probably benign Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Col4a4 A G 1: 82,453,968 S1532P unknown Het
Csf1r G C 18: 61,124,875 G639R probably damaging Het
Dnajc27 T C 12: 4,097,270 L151P possibly damaging Het
Epha5 A G 5: 84,233,654 V446A probably benign Het
Esam T C 9: 37,537,021 V252A probably damaging Het
Flnc C A 6: 29,447,829 D1210E probably damaging Het
Fmn1 G A 2: 113,596,344 M1233I probably benign Het
Fstl4 T C 11: 53,000,223 S63P probably benign Het
Gas2l2 A G 11: 83,423,244 V414A possibly damaging Het
Glra1 G A 11: 55,533,862 P174L probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm16485 A T 9: 8,972,195 N21Y unknown Het
Gm9774 A T 3: 92,429,330 Y22N probably benign Het
Golga7 A T 8: 23,256,715 C24S possibly damaging Het
Ints8 T C 4: 11,227,128 T582A probably benign Het
Irx2 A T 13: 72,629,224 T55S probably benign Het
Lce1j A T 3: 92,789,083 C129* probably null Het
Mocs1 G A 17: 49,454,771 G631E possibly damaging Het
Mpi A T 9: 57,550,598 L107Q probably damaging Het
Msrb2 A G 2: 19,394,355 *176W probably null Het
Myh13 T A 11: 67,340,380 L401Q probably damaging Het
Npffr2 G A 5: 89,582,654 V148I probably benign Het
Oas1a T C 5: 120,897,017 E360G probably benign Het
Olfr1016 A T 2: 85,799,895 I125N probably damaging Het
Olfr1446 A C 19: 12,889,731 V282G probably damaging Het
Olfr726 A T 14: 50,083,910 I257N possibly damaging Het
Pcdha2 A G 18: 36,939,526 D70G probably benign Het
Phf11b T C 14: 59,331,273 S64G probably benign Het
Plpp2 A C 10: 79,530,540 L146R possibly damaging Het
Rad51ap2 A T 12: 11,462,592 R947* probably null Het
Ralgapb A G 2: 158,465,883 H1037R probably benign Het
Rpl21 T C 5: 146,835,892 V141A probably benign Het
Rrnad1 T C 3: 87,927,648 N115S possibly damaging Het
Rufy3 C A 5: 88,642,992 D517E probably benign Het
Scn7a A G 2: 66,757,326 V11A possibly damaging Het
Sipa1l1 A C 12: 82,449,926 Q1744P probably damaging Het
Smc2 T C 4: 52,470,911 probably null Het
Sorcs3 T A 19: 48,764,295 L843Q possibly damaging Het
Strc A T 2: 121,377,363 F509Y probably damaging Het
Tas2r117 A C 6: 132,803,318 T140P probably damaging Het
Tnxb T A 17: 34,709,535 I2641N possibly damaging Het
Tnxb C A 17: 34,710,103 P2707T probably benign Het
Vmn1r4 T A 6: 56,956,530 N6K probably benign Het
Vmn1r91 T A 7: 20,101,293 S46T possibly damaging Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Poc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Poc5 APN 13 96410746 missense probably damaging 1.00
IGL01377:Poc5 APN 13 96401631 missense probably benign 0.35
IGL02981:Poc5 APN 13 96401757 critical splice donor site probably null
IGL03031:Poc5 APN 13 96401615 missense probably benign 0.00
R0348:Poc5 UTSW 13 96398866 missense probably null 1.00
R1533:Poc5 UTSW 13 96391644 missense probably damaging 0.96
R1881:Poc5 UTSW 13 96398731 missense probably benign 0.21
R2171:Poc5 UTSW 13 96410749 missense probably damaging 1.00
R2337:Poc5 UTSW 13 96410603 missense probably damaging 0.98
R3419:Poc5 UTSW 13 96404417 missense possibly damaging 0.88
R3736:Poc5 UTSW 13 96396816 missense probably damaging 1.00
R4554:Poc5 UTSW 13 96403021 missense probably benign 0.40
R5223:Poc5 UTSW 13 96402955 missense probably benign 0.20
R5436:Poc5 UTSW 13 96396813 missense probably damaging 1.00
R6089:Poc5 UTSW 13 96396671 missense probably damaging 1.00
R6700:Poc5 UTSW 13 96394495 missense probably benign 0.00
R7345:Poc5 UTSW 13 96396796 missense probably damaging 1.00
R7354:Poc5 UTSW 13 96394525 missense probably benign 0.02
R7363:Poc5 UTSW 13 96404417 missense possibly damaging 0.88
R7454:Poc5 UTSW 13 96400832 missense possibly damaging 0.93
R7773:Poc5 UTSW 13 96410635 missense probably damaging 1.00
R7786:Poc5 UTSW 13 96404519 missense possibly damaging 0.55
X0019:Poc5 UTSW 13 96394548 frame shift probably null
X0024:Poc5 UTSW 13 96394548 frame shift probably null
X0034:Poc5 UTSW 13 96394548 frame shift probably null
X0035:Poc5 UTSW 13 96394548 frame shift probably null
X0036:Poc5 UTSW 13 96394548 frame shift probably null
X0037:Poc5 UTSW 13 96394548 frame shift probably null
X0038:Poc5 UTSW 13 96394548 frame shift probably null
X0039:Poc5 UTSW 13 96394548 frame shift probably null
X0040:Poc5 UTSW 13 96394548 frame shift probably null
X0052:Poc5 UTSW 13 96394548 frame shift probably null
X0053:Poc5 UTSW 13 96394548 frame shift probably null
X0054:Poc5 UTSW 13 96394548 frame shift probably null
X0058:Poc5 UTSW 13 96394548 frame shift probably null
X0060:Poc5 UTSW 13 96394548 frame shift probably null
X0061:Poc5 UTSW 13 96394548 frame shift probably null
X0062:Poc5 UTSW 13 96394548 frame shift probably null
X0063:Poc5 UTSW 13 96394548 frame shift probably null
Z1176:Poc5 UTSW 13 96401722 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CTCTCAAAGGAATGTGGCTTG -3'
(R):5'- TTCTTAGCAGTATAGACCCAACC -3'

Sequencing Primer
(F):5'- ATCTATAATCTGAGCACTTGGGAGGC -3'
(R):5'- TCACTGATAGCCCCTCAAATTC -3'
Posted On2020-09-15