Incidental Mutation 'R7954:Styxl2'
ID 649699
Institutional Source Beutler Lab
Gene Symbol Styxl2
Ensembl Gene ENSMUSG00000026564
Gene Name serine/threonine/tyrosine interacting like 2
Synonyms C130085G02Rik, Dusp27
MMRRC Submission 045998-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7954 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 165925717-165955467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 165926849 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 921 (S921N)
Ref Sequence ENSEMBL: ENSMUSP00000083155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
AlphaFold Q148W8
Predicted Effect probably benign
Transcript: ENSMUST00000085992
AA Change: S921N

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: S921N

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192369
AA Change: S921N

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: S921N

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 119,903,169 (GRCm39) C409Y possibly damaging Het
Acsm2 C T 7: 119,179,952 (GRCm39) T390I probably damaging Het
Adam20 T C 8: 41,249,581 (GRCm39) Y564H probably damaging Het
Adcy6 A G 15: 98,494,773 (GRCm39) probably null Het
Alms1 T C 6: 85,598,144 (GRCm39) V990A probably damaging Het
Anapc2 T A 2: 25,164,712 (GRCm39) V318E probably damaging Het
Ano6 G T 15: 95,863,702 (GRCm39) A741S possibly damaging Het
Apc A G 18: 34,447,321 (GRCm39) S1406G probably damaging Het
Cemip2 T A 19: 21,770,264 (GRCm39) I84N probably damaging Het
Cfi G A 3: 129,662,234 (GRCm39) probably null Het
Clcn1 A T 6: 42,263,625 (GRCm39) probably benign Het
Crygs C T 16: 22,624,082 (GRCm39) R175H probably damaging Het
Dnmbp A T 19: 43,890,742 (GRCm39) W342R probably benign Het
Dok5 T A 2: 170,674,993 (GRCm39) probably null Het
Eno3 T C 11: 70,552,006 (GRCm39) I284T probably benign Het
Ep400 T C 5: 110,816,599 (GRCm39) T2767A possibly damaging Het
Epb41l4b A G 4: 57,088,034 (GRCm39) V162A probably damaging Het
Fat3 A G 9: 15,909,708 (GRCm39) I2098T probably damaging Het
Fbxl13 T C 5: 21,748,767 (GRCm39) N384S probably benign Het
Fbxo9 A G 9: 78,008,826 (GRCm39) L78P probably benign Het
Glis1 G A 4: 107,476,854 (GRCm39) R525H possibly damaging Het
Gpr15 T G 16: 58,539,047 (GRCm39) D14A probably benign Het
Gpr156 T C 16: 37,807,920 (GRCm39) I189T probably damaging Het
H6pd T C 4: 150,067,283 (GRCm39) I376V probably benign Het
Hs6st3 T C 14: 120,106,522 (GRCm39) V310A probably damaging Het
Htr1b A G 9: 81,513,998 (GRCm39) L203P probably damaging Het
Kif26b A T 1: 178,696,944 (GRCm39) I531F probably damaging Het
Krtcap3 T C 5: 31,410,015 (GRCm39) L166P probably damaging Het
Lmod1 A C 1: 135,252,794 (GRCm39) D16A probably damaging Het
Lrp2 T G 2: 69,333,867 (GRCm39) N1458T possibly damaging Het
Mocs1 G A 17: 49,761,799 (GRCm39) G631E possibly damaging Het
Nop14 G A 5: 34,807,729 (GRCm39) P411L probably benign Het
Nr2f1 A C 13: 78,338,113 (GRCm39) D334E probably damaging Het
Or5al7 A G 2: 85,993,212 (GRCm39) L27P probably damaging Het
Or5p51 T C 7: 107,444,119 (GRCm39) N274D probably benign Het
Paqr9 G A 9: 95,442,681 (GRCm39) V224M probably damaging Het
Pkd2l1 T C 19: 44,142,651 (GRCm39) T464A probably benign Het
Prss58 T C 6: 40,872,543 (GRCm39) R188G possibly damaging Het
Rapgef2 G A 3: 78,977,454 (GRCm39) R1150* probably null Het
Rgs22 A C 15: 36,082,148 (GRCm39) F653V possibly damaging Het
Spata2 T C 2: 167,325,857 (GRCm39) T321A probably benign Het
St3gal1 A T 15: 66,984,422 (GRCm39) F118I probably damaging Het
Tasor T C 14: 27,169,481 (GRCm39) probably null Het
Tex35 C T 1: 156,927,742 (GRCm39) D143N probably damaging Het
Tll1 G A 8: 64,571,568 (GRCm39) T171I probably damaging Het
Umodl1 A T 17: 31,205,361 (GRCm39) Q652L probably benign Het
Usp54 A G 14: 20,611,981 (GRCm39) L945P probably benign Het
Vars1 A G 17: 35,234,960 (GRCm39) H1263R probably benign Het
Vmn1r202 A T 13: 22,685,871 (GRCm39) M182K probably benign Het
Vmn1r78 T A 7: 11,887,227 (GRCm39) C279* probably null Het
Other mutations in Styxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Styxl2 APN 1 165,928,121 (GRCm39) missense probably benign 0.00
IGL00973:Styxl2 APN 1 165,927,027 (GRCm39) missense probably benign
IGL01331:Styxl2 APN 1 165,935,749 (GRCm39) missense probably damaging 1.00
IGL01466:Styxl2 APN 1 165,928,073 (GRCm39) missense probably damaging 1.00
IGL01572:Styxl2 APN 1 165,927,941 (GRCm39) missense probably benign 0.18
IGL01906:Styxl2 APN 1 165,927,092 (GRCm39) missense probably damaging 1.00
IGL01974:Styxl2 APN 1 165,928,105 (GRCm39) nonsense probably null
IGL02112:Styxl2 APN 1 165,927,240 (GRCm39) nonsense probably null
IGL02805:Styxl2 APN 1 165,926,630 (GRCm39) missense probably damaging 1.00
IGL03343:Styxl2 APN 1 165,927,017 (GRCm39) missense probably benign 0.00
R0116:Styxl2 UTSW 1 165,927,270 (GRCm39) missense probably benign 0.19
R0367:Styxl2 UTSW 1 165,928,332 (GRCm39) missense probably benign 0.05
R0499:Styxl2 UTSW 1 165,926,670 (GRCm39) missense probably benign 0.00
R0542:Styxl2 UTSW 1 165,928,853 (GRCm39) missense possibly damaging 0.90
R1312:Styxl2 UTSW 1 165,926,860 (GRCm39) missense possibly damaging 0.46
R1572:Styxl2 UTSW 1 165,927,024 (GRCm39) missense possibly damaging 0.68
R1598:Styxl2 UTSW 1 165,937,828 (GRCm39) missense probably benign 0.10
R1858:Styxl2 UTSW 1 165,928,415 (GRCm39) missense possibly damaging 0.87
R2021:Styxl2 UTSW 1 165,928,392 (GRCm39) missense probably benign 0.00
R2970:Styxl2 UTSW 1 165,926,798 (GRCm39) missense probably benign 0.04
R3727:Styxl2 UTSW 1 165,927,075 (GRCm39) missense probably damaging 1.00
R4041:Styxl2 UTSW 1 165,927,680 (GRCm39) missense probably benign 0.01
R4245:Styxl2 UTSW 1 165,928,685 (GRCm39) missense probably damaging 1.00
R4955:Styxl2 UTSW 1 165,935,661 (GRCm39) missense probably damaging 1.00
R4967:Styxl2 UTSW 1 165,954,675 (GRCm39) missense probably damaging 1.00
R5040:Styxl2 UTSW 1 165,927,914 (GRCm39) missense probably benign 0.17
R5342:Styxl2 UTSW 1 165,937,819 (GRCm39) missense probably benign 0.01
R5467:Styxl2 UTSW 1 165,939,599 (GRCm39) critical splice donor site probably null
R5742:Styxl2 UTSW 1 165,927,023 (GRCm39) missense probably benign 0.00
R6222:Styxl2 UTSW 1 165,926,214 (GRCm39) missense probably benign 0.26
R6239:Styxl2 UTSW 1 165,926,388 (GRCm39) missense probably damaging 1.00
R6531:Styxl2 UTSW 1 165,937,615 (GRCm39) splice site probably null
R6586:Styxl2 UTSW 1 165,928,454 (GRCm39) missense possibly damaging 0.79
R6958:Styxl2 UTSW 1 165,935,565 (GRCm39) missense probably damaging 1.00
R7006:Styxl2 UTSW 1 165,926,663 (GRCm39) missense probably benign
R7111:Styxl2 UTSW 1 165,954,723 (GRCm39) missense possibly damaging 0.66
R7310:Styxl2 UTSW 1 165,926,300 (GRCm39) missense possibly damaging 0.46
R7312:Styxl2 UTSW 1 165,954,676 (GRCm39) missense probably damaging 0.99
R7378:Styxl2 UTSW 1 165,939,632 (GRCm39) nonsense probably null
R7398:Styxl2 UTSW 1 165,928,044 (GRCm39) missense probably damaging 1.00
R7442:Styxl2 UTSW 1 165,928,584 (GRCm39) missense probably benign 0.01
R7569:Styxl2 UTSW 1 165,935,604 (GRCm39) missense probably damaging 1.00
R7920:Styxl2 UTSW 1 165,927,465 (GRCm39) missense possibly damaging 0.72
R7972:Styxl2 UTSW 1 165,926,708 (GRCm39) missense probably damaging 1.00
R8186:Styxl2 UTSW 1 165,927,648 (GRCm39) missense probably damaging 1.00
R8354:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8454:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8535:Styxl2 UTSW 1 165,928,730 (GRCm39) missense probably benign 0.01
R9419:Styxl2 UTSW 1 165,927,755 (GRCm39) missense probably damaging 1.00
R9493:Styxl2 UTSW 1 165,926,410 (GRCm39) missense probably damaging 1.00
R9694:Styxl2 UTSW 1 165,928,654 (GRCm39) missense probably damaging 1.00
Z1088:Styxl2 UTSW 1 165,926,852 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATTGGCTTCGTGGAAGG -3'
(R):5'- GGCCTCTGATAACAAGCGTAG -3'

Sequencing Primer
(F):5'- GAGGTGTCCTGCTCCTGTGAC -3'
(R):5'- GACATGAGCGTGGGTGAC -3'
Posted On 2020-09-15