Mutagenetix > Incidental Mutation

Incidental Mutation 'R7954:Glis1'

649709

Institutional Source

Beutler Lab

Gene Symbol

Glis1

Ensembl Gene

ENSMUSG00000034762

Gene Name

GLIS family zinc finger 1

Synonyms

GliH1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7954 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107434591-107635061 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 107619657 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 525 (R525H)

Ref Sequence

ENSEMBL: ENSMUSP00000035650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046005] [ENSMUST00000106738]

AlphaFold

Q8K1M4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046005
AA Change: R525H

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000035650
Gene: ENSMUSG00000034762
AA Change: R525H

Domain	Start	End	E-Value	Type
low complexity region	50	62	N/A	INTRINSIC
low complexity region	118	129	N/A	INTRINSIC
low complexity region	242	255	N/A	INTRINSIC
low complexity region	274	288	N/A	INTRINSIC
low complexity region	334	357	N/A	INTRINSIC
ZnF_C2H2	366	391	3.99e0	SMART
ZnF_C2H2	400	427	4.12e0	SMART
ZnF_C2H2	433	457	7.78e-3	SMART
ZnF_C2H2	463	487	1.45e-2	SMART
ZnF_C2H2	493	517	5.59e-4	SMART
low complexity region	543	557	N/A	INTRINSIC
low complexity region	635	658	N/A	INTRINSIC
low complexity region	666	686	N/A	INTRINSIC
low complexity region	721	735	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106738
AA Change: R337H

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000102349
Gene: ENSMUSG00000034762
AA Change: R337H

Domain	Start	End	E-Value	Type
low complexity region	54	67	N/A	INTRINSIC
low complexity region	86	100	N/A	INTRINSIC
low complexity region	146	169	N/A	INTRINSIC
ZnF_C2H2	178	203	3.99e0	SMART
ZnF_C2H2	212	239	4.12e0	SMART
ZnF_C2H2	245	269	7.78e-3	SMART
ZnF_C2H2	275	299	1.45e-2	SMART
ZnF_C2H2	305	329	5.59e-4	SMART
low complexity region	355	369	N/A	INTRINSIC
low complexity region	447	470	N/A	INTRINSIC
low complexity region	478	498	N/A	INTRINSIC
low complexity region	533	547	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GLIS1 is a GLI (MIM 165220)-related Kruppel-like zinc finger protein that functions as an activator and repressor of transcription (Kim et al., 2002 [PubMed 12042312]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mice do not exhibit any overt abnormalities, including behavior, kidney or tooth morphology, up to 6 months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,012,343	C409Y	possibly damaging	Het
Acsm2	C	T	7: 119,580,729	T390I	probably damaging	Het
Adam20	T	C	8: 40,796,544	Y564H	probably damaging	Het
Adcy6	A	G	15: 98,596,892		probably null	Het
Alms1	T	C	6: 85,621,162	V990A	probably damaging	Het
Anapc2	T	A	2: 25,274,700	V318E	probably damaging	Het
Ano6	G	T	15: 95,965,821	A741S	possibly damaging	Het
Apc	A	G	18: 34,314,268	S1406G	probably damaging	Het
Cfi	G	A	3: 129,868,585		probably null	Het
Clcn1	A	T	6: 42,286,691		probably benign	Het
Crygs	C	T	16: 22,805,332	R175H	probably damaging	Het
Dnmbp	A	T	19: 43,902,303	W342R	probably benign	Het
Dok5	T	A	2: 170,833,073		probably null	Het
Dusp27	C	T	1: 166,099,280	S921N	probably benign	Het
Eno3	T	C	11: 70,661,180	I284T	probably benign	Het
Ep400	T	C	5: 110,668,733	T2767A	possibly damaging	Het
Epb41l4b	A	G	4: 57,088,034	V162A	probably damaging	Het
Fam208a	T	C	14: 27,447,524		probably null	Het
Fat3	A	G	9: 15,998,412	I2098T	probably damaging	Het
Fbxl13	T	C	5: 21,543,769	N384S	probably benign	Het
Fbxo9	A	G	9: 78,101,544	L78P	probably benign	Het
Gpr15	T	G	16: 58,718,684	D14A	probably benign	Het
Gpr156	T	C	16: 37,987,558	I189T	probably damaging	Het
H6pd	T	C	4: 149,982,826	I376V	probably benign	Het
Hs6st3	T	C	14: 119,869,110	V310A	probably damaging	Het
Htr1b	A	G	9: 81,631,945	L203P	probably damaging	Het
Kif26b	A	T	1: 178,869,379	I531F	probably damaging	Het
Krtcap3	T	C	5: 31,252,671	L166P	probably damaging	Het
Lmod1	A	C	1: 135,325,056	D16A	probably damaging	Het
Lrp2	T	G	2: 69,503,523	N1458T	possibly damaging	Het
Mocs1	G	A	17: 49,454,771	G631E	possibly damaging	Het
Nop14	G	A	5: 34,650,385	P411L	probably benign	Het
Nr2f1	A	C	13: 78,189,994	D334E	probably damaging	Het
Olfr1043	A	G	2: 86,162,868	L27P	probably damaging	Het
Olfr470	T	C	7: 107,844,912	N274D	probably benign	Het
Paqr9	G	A	9: 95,560,628	V224M	probably damaging	Het
Pkd2l1	T	C	19: 44,154,212	T464A	probably benign	Het
Prss58	T	C	6: 40,895,609	R188G	possibly damaging	Het
Rapgef2	G	A	3: 79,070,147	R1150*	probably null	Het
Rgs22	A	C	15: 36,082,002	F653V	possibly damaging	Het
Spata2	T	C	2: 167,483,937	T321A	probably benign	Het
St3gal1	A	T	15: 67,112,573	F118I	probably damaging	Het
Tex35	C	T	1: 157,100,172	D143N	probably damaging	Het
Tll1	G	A	8: 64,118,534	T171I	probably damaging	Het
Tmem2	T	A	19: 21,792,900	I84N	probably damaging	Het
Umodl1	A	T	17: 30,986,387	Q652L	probably benign	Het
Usp54	A	G	14: 20,561,913	L945P	probably benign	Het
Vars	A	G	17: 35,015,984	H1263R	probably benign	Het
Vmn1r202	A	T	13: 22,501,701	M182K	probably benign	Het
Vmn1r78	T	A	7: 12,153,300	C279*	probably null	Het

Other mutations in Glis1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02157:Glis1	APN	4	107627561	missense	probably benign	0.01
IGL02450:Glis1	APN	4	107627529	missense	probably benign	0.25
IGL03167:Glis1	APN	4	107435905	missense	possibly damaging	0.90
IGL03189:Glis1	APN	4	107615051	missense	probably damaging	1.00
IGL03377:Glis1	APN	4	107632281	missense	probably damaging	0.98
glenys	UTSW	4	107627543	missense	possibly damaging	0.91
R0551:Glis1	UTSW	4	107568119	splice site	probably null
R0981:Glis1	UTSW	4	107615042	missense	probably damaging	1.00
R1036:Glis1	UTSW	4	107632264	missense	probably benign	0.05
R1527:Glis1	UTSW	4	107567926	missense	probably damaging	0.96
R1741:Glis1	UTSW	4	107568347	missense	probably damaging	1.00
R2937:Glis1	UTSW	4	107632291	missense	possibly damaging	0.89
R2938:Glis1	UTSW	4	107632291	missense	possibly damaging	0.89
R4223:Glis1	UTSW	4	107567845	missense	probably benign	0.01
R4412:Glis1	UTSW	4	107634718	missense	probably damaging	0.99
R4587:Glis1	UTSW	4	107627543	missense	possibly damaging	0.91
R4685:Glis1	UTSW	4	107567645	missense	probably benign	0.00
R4900:Glis1	UTSW	4	107619564	missense	probably damaging	1.00
R5138:Glis1	UTSW	4	107623105	frame shift	probably null
R5167:Glis1	UTSW	4	107634694	missense	probably damaging	1.00
R5511:Glis1	UTSW	4	107435877	missense	probably damaging	0.99
R5568:Glis1	UTSW	4	107619635	missense	probably damaging	0.99
R5807:Glis1	UTSW	4	107568082	missense	probably benign	0.00
R6006:Glis1	UTSW	4	107567906	missense	probably damaging	1.00
R6180:Glis1	UTSW	4	107627513	missense	probably benign	0.06
R6219:Glis1	UTSW	4	107631905	missense	probably benign	0.27
R6856:Glis1	UTSW	4	107435879	missense	probably damaging	0.96
R7278:Glis1	UTSW	4	107435683	start codon destroyed	probably null	0.53
R7877:Glis1	UTSW	4	107634703	missense	probably damaging	1.00
R7937:Glis1	UTSW	4	107627526	missense	possibly damaging	0.68
R7940:Glis1	UTSW	4	107632374	missense	probably damaging	1.00
R7940:Glis1	UTSW	4	107632375	missense	probably damaging	0.99
R8078:Glis1	UTSW	4	107567902	missense	probably damaging	1.00
R8931:Glis1	UTSW	4	107563863	missense	probably benign	0.35
R9227:Glis1	UTSW	4	107568130	missense	probably benign	0.45
R9230:Glis1	UTSW	4	107568130	missense	probably benign	0.45
R9767:Glis1	UTSW	4	107634597	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CACATAAGGGACCGTCATCTTC -3'
(R):5'- ATCAGTGCCACAGCTAAGGG -3'

Sequencing Primer
(F):5'- TAAGGGACCGTCATCTTCAACAGTG -3'
(R):5'- GCCACAGCTAAGGGTACCAGTC -3'

Posted On

2020-09-15