Incidental Mutation 'R7954:Prss58'
ID649715
Institutional Source Beutler Lab
Gene Symbol Prss58
Ensembl Gene ENSMUSG00000051936
Gene Nameprotease, serine 58
SynonymsBC048599
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R7954 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location40895270-40900387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40895609 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 188 (R188G)
Ref Sequence ENSEMBL: ENSMUSP00000069833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063523] [ENSMUST00000103262]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063523
AA Change: R188G

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069833
Gene: ENSMUSG00000051936
AA Change: R188G

DomainStartEndE-ValueType
Tryp_SPc 22 234 4.49e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103262
SMART Domains Protein: ENSMUSP00000100078
Gene: ENSMUSG00000076461

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:V-set 22 116 8.4e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. This gene and several related trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. This gene was previously described as a trypsinogen-like pseudogene, but it is now thought to be a protein-coding gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,343 C409Y possibly damaging Het
Acsm2 C T 7: 119,580,729 T390I probably damaging Het
Adam20 T C 8: 40,796,544 Y564H probably damaging Het
Adcy6 A G 15: 98,596,892 probably null Het
Alms1 T C 6: 85,621,162 V990A probably damaging Het
Anapc2 T A 2: 25,274,700 V318E probably damaging Het
Ano6 G T 15: 95,965,821 A741S possibly damaging Het
Apc A G 18: 34,314,268 S1406G probably damaging Het
Cfi G A 3: 129,868,585 probably null Het
Clcn1 A T 6: 42,286,691 probably benign Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Dnmbp A T 19: 43,902,303 W342R probably benign Het
Dok5 T A 2: 170,833,073 probably null Het
Dusp27 C T 1: 166,099,280 S921N probably benign Het
Eno3 T C 11: 70,661,180 I284T probably benign Het
Ep400 T C 5: 110,668,733 T2767A possibly damaging Het
Epb41l4b A G 4: 57,088,034 V162A probably damaging Het
Fam208a T C 14: 27,447,524 probably null Het
Fat3 A G 9: 15,998,412 I2098T probably damaging Het
Fbxl13 T C 5: 21,543,769 N384S probably benign Het
Fbxo9 A G 9: 78,101,544 L78P probably benign Het
Glis1 G A 4: 107,619,657 R525H possibly damaging Het
Gpr15 T G 16: 58,718,684 D14A probably benign Het
Gpr156 T C 16: 37,987,558 I189T probably damaging Het
H6pd T C 4: 149,982,826 I376V probably benign Het
Hs6st3 T C 14: 119,869,110 V310A probably damaging Het
Htr1b A G 9: 81,631,945 L203P probably damaging Het
Kif26b A T 1: 178,869,379 I531F probably damaging Het
Krtcap3 T C 5: 31,252,671 L166P probably damaging Het
Lmod1 A C 1: 135,325,056 D16A probably damaging Het
Lrp2 T G 2: 69,503,523 N1458T possibly damaging Het
Mocs1 G A 17: 49,454,771 G631E possibly damaging Het
Nop14 G A 5: 34,650,385 P411L probably benign Het
Nr2f1 A C 13: 78,189,994 D334E probably damaging Het
Olfr1043 A G 2: 86,162,868 L27P probably damaging Het
Olfr470 T C 7: 107,844,912 N274D probably benign Het
Paqr9 G A 9: 95,560,628 V224M probably damaging Het
Pkd2l1 T C 19: 44,154,212 T464A probably benign Het
Rapgef2 G A 3: 79,070,147 R1150* probably null Het
Rgs22 A C 15: 36,082,002 F653V possibly damaging Het
Spata2 T C 2: 167,483,937 T321A probably benign Het
St3gal1 A T 15: 67,112,573 F118I probably damaging Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tll1 G A 8: 64,118,534 T171I probably damaging Het
Tmem2 T A 19: 21,792,900 I84N probably damaging Het
Umodl1 A T 17: 30,986,387 Q652L probably benign Het
Usp54 A G 14: 20,561,913 L945P probably benign Het
Vars A G 17: 35,015,984 H1263R probably benign Het
Vmn1r202 A T 13: 22,501,701 M182K probably benign Het
Vmn1r78 T A 7: 12,153,300 C279* probably null Het
Other mutations in Prss58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Prss58 APN 6 40895465 missense probably damaging 1.00
IGL01108:Prss58 APN 6 40897344 missense probably damaging 1.00
IGL01645:Prss58 APN 6 40897310 missense probably damaging 0.98
R0032:Prss58 UTSW 6 40895699 missense probably benign 0.00
R0032:Prss58 UTSW 6 40895699 missense probably benign 0.00
R1622:Prss58 UTSW 6 40897314 missense possibly damaging 0.84
R2511:Prss58 UTSW 6 40897800 missense probably damaging 1.00
R4292:Prss58 UTSW 6 40897310 missense probably damaging 0.98
R5093:Prss58 UTSW 6 40897817 missense probably damaging 1.00
R5601:Prss58 UTSW 6 40897849 missense possibly damaging 0.92
R5992:Prss58 UTSW 6 40897769 missense probably damaging 1.00
R6806:Prss58 UTSW 6 40897732 missense probably damaging 0.98
R7105:Prss58 UTSW 6 40897766 missense probably damaging 1.00
R7136:Prss58 UTSW 6 40900053 critical splice donor site probably null
R7344:Prss58 UTSW 6 40895465 missense probably damaging 1.00
R7699:Prss58 UTSW 6 40895388 missense probably damaging 1.00
R7700:Prss58 UTSW 6 40895388 missense probably damaging 1.00
R8305:Prss58 UTSW 6 40895660 missense probably benign 0.00
R8370:Prss58 UTSW 6 40895424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCTCCTGTTGTGGGAGC -3'
(R):5'- CCTAAGGGGATGGACTTTTGC -3'

Sequencing Primer
(F):5'- CATGGTATCTTCAATCCAGGGCAAG -3'
(R):5'- GGATGGACTTTTGCATTATGACAAG -3'
Posted On2020-09-15