Incidental Mutation 'R7954:Vmn1r78'
ID649718
Institutional Source Beutler Lab
Gene Symbol Vmn1r78
Ensembl Gene ENSMUSG00000061602
Gene Namevomeronasal 1 receptor 78
SynonymsV1rg7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7954 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12150257-12159959 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 12153300 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 279 (C279*)
Ref Sequence ENSEMBL: ENSMUSP00000077186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078039] [ENSMUST00000228244] [ENSMUST00000228664]
Predicted Effect probably null
Transcript: ENSMUST00000078039
AA Change: C279*
SMART Domains Protein: ENSMUSP00000077186
Gene: ENSMUSG00000061602
AA Change: C279*

DomainStartEndE-ValueType
Pfam:TAS2R 3 304 5.7e-8 PFAM
Pfam:V1R 12 301 1.5e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000228244
AA Change: C279*
Predicted Effect probably null
Transcript: ENSMUST00000228664
AA Change: C279*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,343 C409Y possibly damaging Het
Acsm2 C T 7: 119,580,729 T390I probably damaging Het
Adam20 T C 8: 40,796,544 Y564H probably damaging Het
Adcy6 A G 15: 98,596,892 probably null Het
Alms1 T C 6: 85,621,162 V990A probably damaging Het
Anapc2 T A 2: 25,274,700 V318E probably damaging Het
Ano6 G T 15: 95,965,821 A741S possibly damaging Het
Apc A G 18: 34,314,268 S1406G probably damaging Het
Cfi G A 3: 129,868,585 probably null Het
Clcn1 A T 6: 42,286,691 probably benign Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Dnmbp A T 19: 43,902,303 W342R probably benign Het
Dok5 T A 2: 170,833,073 probably null Het
Dusp27 C T 1: 166,099,280 S921N probably benign Het
Eno3 T C 11: 70,661,180 I284T probably benign Het
Ep400 T C 5: 110,668,733 T2767A possibly damaging Het
Epb41l4b A G 4: 57,088,034 V162A probably damaging Het
Fam208a T C 14: 27,447,524 probably null Het
Fat3 A G 9: 15,998,412 I2098T probably damaging Het
Fbxl13 T C 5: 21,543,769 N384S probably benign Het
Fbxo9 A G 9: 78,101,544 L78P probably benign Het
Glis1 G A 4: 107,619,657 R525H possibly damaging Het
Gpr15 T G 16: 58,718,684 D14A probably benign Het
Gpr156 T C 16: 37,987,558 I189T probably damaging Het
H6pd T C 4: 149,982,826 I376V probably benign Het
Hs6st3 T C 14: 119,869,110 V310A probably damaging Het
Htr1b A G 9: 81,631,945 L203P probably damaging Het
Kif26b A T 1: 178,869,379 I531F probably damaging Het
Krtcap3 T C 5: 31,252,671 L166P probably damaging Het
Lmod1 A C 1: 135,325,056 D16A probably damaging Het
Lrp2 T G 2: 69,503,523 N1458T possibly damaging Het
Mocs1 G A 17: 49,454,771 G631E possibly damaging Het
Nop14 G A 5: 34,650,385 P411L probably benign Het
Nr2f1 A C 13: 78,189,994 D334E probably damaging Het
Olfr1043 A G 2: 86,162,868 L27P probably damaging Het
Olfr470 T C 7: 107,844,912 N274D probably benign Het
Paqr9 G A 9: 95,560,628 V224M probably damaging Het
Pkd2l1 T C 19: 44,154,212 T464A probably benign Het
Prss58 T C 6: 40,895,609 R188G possibly damaging Het
Rapgef2 G A 3: 79,070,147 R1150* probably null Het
Rgs22 A C 15: 36,082,002 F653V possibly damaging Het
Spata2 T C 2: 167,483,937 T321A probably benign Het
St3gal1 A T 15: 67,112,573 F118I probably damaging Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tll1 G A 8: 64,118,534 T171I probably damaging Het
Tmem2 T A 19: 21,792,900 I84N probably damaging Het
Umodl1 A T 17: 30,986,387 Q652L probably benign Het
Usp54 A G 14: 20,561,913 L945P probably benign Het
Vars A G 17: 35,015,984 H1263R probably benign Het
Vmn1r202 A T 13: 22,501,701 M182K probably benign Het
Other mutations in Vmn1r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Vmn1r78 APN 7 12153238 missense probably benign 0.10
IGL02019:Vmn1r78 APN 7 12152707 missense probably damaging 0.99
IGL02143:Vmn1r78 APN 7 12152480 missense probably benign
IGL02154:Vmn1r78 APN 7 12152545 missense probably benign 0.22
IGL02290:Vmn1r78 APN 7 12153155 missense probably damaging 1.00
IGL03012:Vmn1r78 APN 7 12153364 missense probably benign 0.32
IGL03256:Vmn1r78 APN 7 12152798 missense probably damaging 1.00
IGL03373:Vmn1r78 APN 7 12153343 missense possibly damaging 0.86
IGL03384:Vmn1r78 APN 7 12153209 missense possibly damaging 0.94
R0016:Vmn1r78 UTSW 7 12153352 missense probably benign 0.02
R1445:Vmn1r78 UTSW 7 12152581 missense possibly damaging 0.64
R1748:Vmn1r78 UTSW 7 12153323 missense probably damaging 1.00
R2017:Vmn1r78 UTSW 7 12153343 missense possibly damaging 0.86
R2032:Vmn1r78 UTSW 7 12153283 missense probably benign 0.00
R2198:Vmn1r78 UTSW 7 12152560 missense probably benign 0.06
R4330:Vmn1r78 UTSW 7 12152459 splice site probably null
R4564:Vmn1r78 UTSW 7 12152558 missense probably damaging 1.00
R4769:Vmn1r78 UTSW 7 12152798 missense probably damaging 1.00
R4801:Vmn1r78 UTSW 7 12152964 nonsense probably null
R4802:Vmn1r78 UTSW 7 12152964 nonsense probably null
R4860:Vmn1r78 UTSW 7 12152756 missense probably damaging 1.00
R4860:Vmn1r78 UTSW 7 12152756 missense probably damaging 1.00
R5648:Vmn1r78 UTSW 7 12152766 missense possibly damaging 0.92
R6561:Vmn1r78 UTSW 7 12152899 missense probably damaging 1.00
R6869:Vmn1r78 UTSW 7 12152749 missense probably benign 0.01
R6945:Vmn1r78 UTSW 7 12152905 missense probably benign 0.01
R7793:Vmn1r78 UTSW 7 12153314 missense probably benign 0.01
Z1088:Vmn1r78 UTSW 7 12152714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTGAGTGTCCTCTACAGACAC -3'
(R):5'- GACTGCAGTCTTAGCATTCTACAATAG -3'

Sequencing Primer
(F):5'- GTCAAGCATATCCATAGTGCTCAG -3'
(R):5'- CTTAGCATTCTACAATAGATACAGGG -3'
Posted On2020-09-15