Incidental Mutation 'R7954:Ano6'
ID649736
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Nameanoctamin 6
SynonymsTmem16f, 2900059G15Rik, F730003B03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R7954 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location95790843-95974751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 95965821 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 741 (A741S)
Ref Sequence ENSEMBL: ENSMUSP00000071770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000227151] [ENSMUST00000227791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071874
AA Change: A741S

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210
AA Change: A741S

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227151
Predicted Effect possibly damaging
Transcript: ENSMUST00000227791
AA Change: A762S

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,343 C409Y possibly damaging Het
Acsm2 C T 7: 119,580,729 T390I probably damaging Het
Adam20 T C 8: 40,796,544 Y564H probably damaging Het
Adcy6 A G 15: 98,596,892 probably null Het
Alms1 T C 6: 85,621,162 V990A probably damaging Het
Anapc2 T A 2: 25,274,700 V318E probably damaging Het
Apc A G 18: 34,314,268 S1406G probably damaging Het
Cfi G A 3: 129,868,585 probably null Het
Clcn1 A T 6: 42,286,691 probably benign Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Dnmbp A T 19: 43,902,303 W342R probably benign Het
Dok5 T A 2: 170,833,073 probably null Het
Dusp27 C T 1: 166,099,280 S921N probably benign Het
Eno3 T C 11: 70,661,180 I284T probably benign Het
Ep400 T C 5: 110,668,733 T2767A possibly damaging Het
Epb41l4b A G 4: 57,088,034 V162A probably damaging Het
Fam208a T C 14: 27,447,524 probably null Het
Fat3 A G 9: 15,998,412 I2098T probably damaging Het
Fbxl13 T C 5: 21,543,769 N384S probably benign Het
Fbxo9 A G 9: 78,101,544 L78P probably benign Het
Glis1 G A 4: 107,619,657 R525H possibly damaging Het
Gpr15 T G 16: 58,718,684 D14A probably benign Het
Gpr156 T C 16: 37,987,558 I189T probably damaging Het
H6pd T C 4: 149,982,826 I376V probably benign Het
Hs6st3 T C 14: 119,869,110 V310A probably damaging Het
Htr1b A G 9: 81,631,945 L203P probably damaging Het
Kif26b A T 1: 178,869,379 I531F probably damaging Het
Krtcap3 T C 5: 31,252,671 L166P probably damaging Het
Lmod1 A C 1: 135,325,056 D16A probably damaging Het
Lrp2 T G 2: 69,503,523 N1458T possibly damaging Het
Mocs1 G A 17: 49,454,771 G631E possibly damaging Het
Nop14 G A 5: 34,650,385 P411L probably benign Het
Nr2f1 A C 13: 78,189,994 D334E probably damaging Het
Olfr1043 A G 2: 86,162,868 L27P probably damaging Het
Olfr470 T C 7: 107,844,912 N274D probably benign Het
Paqr9 G A 9: 95,560,628 V224M probably damaging Het
Pkd2l1 T C 19: 44,154,212 T464A probably benign Het
Prss58 T C 6: 40,895,609 R188G possibly damaging Het
Rapgef2 G A 3: 79,070,147 R1150* probably null Het
Rgs22 A C 15: 36,082,002 F653V possibly damaging Het
Spata2 T C 2: 167,483,937 T321A probably benign Het
St3gal1 A T 15: 67,112,573 F118I probably damaging Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tll1 G A 8: 64,118,534 T171I probably damaging Het
Tmem2 T A 19: 21,792,900 I84N probably damaging Het
Umodl1 A T 17: 30,986,387 Q652L probably benign Het
Usp54 A G 14: 20,561,913 L945P probably benign Het
Vars A G 17: 35,015,984 H1263R probably benign Het
Vmn1r202 A T 13: 22,501,701 M182K probably benign Het
Vmn1r78 T A 7: 12,153,300 C279* probably null Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95948429 missense probably damaging 1.00
IGL01308:Ano6 APN 15 95913661 splice site probably null
IGL01490:Ano6 APN 15 95948410 missense probably benign 0.08
IGL01663:Ano6 APN 15 95967614 splice site probably null
IGL01783:Ano6 APN 15 95962262 missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95955944 missense probably benign 0.00
IGL02114:Ano6 APN 15 95943460 missense probably damaging 0.96
IGL02683:Ano6 APN 15 95948312 missense probably damaging 1.00
IGL03297:Ano6 APN 15 95962277 missense probably damaging 1.00
IGL03401:Ano6 APN 15 95949905 missense probably damaging 1.00
R0730:Ano6 UTSW 15 95920371 missense probably damaging 1.00
R1086:Ano6 UTSW 15 95949962 splice site probably null
R1264:Ano6 UTSW 15 95949566 missense probably damaging 1.00
R1421:Ano6 UTSW 15 95913385 missense probably benign 0.13
R1494:Ano6 UTSW 15 95972507 missense probably damaging 0.98
R1755:Ano6 UTSW 15 95972570 missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95962267 missense probably damaging 1.00
R2042:Ano6 UTSW 15 95956023 critical splice donor site probably null
R2393:Ano6 UTSW 15 95966025 critical splice donor site probably benign
R2415:Ano6 UTSW 15 95962280 missense probably damaging 1.00
R2483:Ano6 UTSW 15 95965974 missense probably benign 0.00
R2879:Ano6 UTSW 15 95943427 nonsense probably null
R3440:Ano6 UTSW 15 95967721 missense probably damaging 1.00
R3716:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3717:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3718:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3887:Ano6 UTSW 15 95894449 missense possibly damaging 0.64
R4175:Ano6 UTSW 15 95962169 missense probably damaging 1.00
R4214:Ano6 UTSW 15 95965909 missense probably benign
R4591:Ano6 UTSW 15 95943427 nonsense probably null
R5249:Ano6 UTSW 15 95913588 missense probably benign 0.35
R5383:Ano6 UTSW 15 95916037 missense probably benign 0.00
R5496:Ano6 UTSW 15 95967614 splice site probably null
R5532:Ano6 UTSW 15 95962241 missense probably damaging 1.00
R5598:Ano6 UTSW 15 95941347 missense probably damaging 1.00
R5645:Ano6 UTSW 15 95920351 missense probably benign 0.03
R5739:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R5794:Ano6 UTSW 15 95894524 missense probably benign 0.00
R5864:Ano6 UTSW 15 95920380 critical splice donor site probably null
R5936:Ano6 UTSW 15 95972601 missense probably damaging 1.00
R5937:Ano6 UTSW 15 95913957 missense probably damaging 0.98
R6063:Ano6 UTSW 15 95948417 missense probably damaging 1.00
R6191:Ano6 UTSW 15 95948499 critical splice donor site probably null
R6275:Ano6 UTSW 15 95913433 missense probably damaging 1.00
R6349:Ano6 UTSW 15 95966022 missense probably damaging 0.97
R6468:Ano6 UTSW 15 95967714 missense probably benign 0.01
R6734:Ano6 UTSW 15 95949536 missense probably damaging 0.99
R6830:Ano6 UTSW 15 95894461 missense probably damaging 1.00
R6883:Ano6 UTSW 15 95962111 missense probably damaging 1.00
R6892:Ano6 UTSW 15 95967624 missense probably damaging 1.00
R7171:Ano6 UTSW 15 95920291 missense probably damaging 1.00
R7271:Ano6 UTSW 15 95913900 missense probably damaging 1.00
R7284:Ano6 UTSW 15 95948303 missense probably damaging 1.00
R7326:Ano6 UTSW 15 95864244 missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95972589 missense probably damaging 1.00
R7944:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7945:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R8496:Ano6 UTSW 15 95949926 missense probably damaging 1.00
X0066:Ano6 UTSW 15 95943434 missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95913460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGAGGCAACCAATGGTCC -3'
(R):5'- GGTGAATCAAAACTTGCCTGC -3'

Sequencing Primer
(F):5'- GAGGCAACCAATGGTCCTTTCAAC -3'
(R):5'- AACTTGCCTGCACAAGGTATAG -3'
Posted On2020-09-15