Incidental Mutation 'R7955:Myo3b'
ID 649751
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 045999-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7955 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69925623 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 58 (Y58F)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112241] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: Y58F

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: Y58F

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112241
SMART Domains Protein: ENSMUSP00000107860
Gene: ENSMUSG00000042064

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 187 3.7e-30 PFAM
Pfam:Pkinase 1 188 8.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: Y30F

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: Y30F

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 T A 17: 33,764,613 (GRCm39) V711D probably damaging Het
Adgrg5 G A 8: 95,664,325 (GRCm39) V312M Het
Ankrd53 A G 6: 83,744,845 (GRCm39) T352A probably benign Het
Ano4 T A 10: 88,831,088 (GRCm39) M512L probably null Het
AW551984 A G 9: 39,507,960 (GRCm39) F392S probably damaging Het
Chrna7 T G 7: 62,753,541 (GRCm39) K326T possibly damaging Het
Cldnd2 G T 7: 43,091,120 (GRCm39) L17F possibly damaging Het
Clvs2 T C 10: 33,471,808 (GRCm39) N166D possibly damaging Het
Cox10 A T 11: 63,884,750 (GRCm39) N218K probably benign Het
Crygs C T 16: 22,624,082 (GRCm39) R175H probably damaging Het
Daxx T A 17: 34,131,229 (GRCm39) Y385* probably null Het
Dnmbp T C 19: 43,890,762 (GRCm39) E335G probably benign Het
Erich3 C T 3: 154,444,951 (GRCm39) Q376* probably null Het
Flot2 A G 11: 77,949,769 (GRCm39) probably null Het
Ganc A G 2: 120,261,181 (GRCm39) T289A probably damaging Het
Gm19668 G A 10: 77,634,630 (GRCm39) T113I unknown Het
Gpm6a A G 8: 55,511,840 (GRCm39) N238S probably damaging Het
Hps1 T C 19: 42,759,221 (GRCm39) T124A probably damaging Het
Larp4b T C 13: 9,186,816 (GRCm39) V48A probably benign Het
Magi2 A G 5: 20,594,070 (GRCm39) H205R probably damaging Het
Map2 T A 1: 66,452,875 (GRCm39) S588R probably damaging Het
Mocos A G 18: 24,799,216 (GRCm39) D150G probably damaging Het
Msl2 A G 9: 100,979,354 (GRCm39) D576G possibly damaging Het
Mybpc3 A G 2: 90,956,401 (GRCm39) probably null Het
Ndst3 T G 3: 123,400,586 (GRCm39) K440T probably benign Het
Ndst4 T A 3: 125,231,831 (GRCm39) Y133* probably null Het
Nrcam G A 12: 44,631,737 (GRCm39) V1097M probably benign Het
Or6z1 A G 7: 6,505,078 (GRCm39) I49T possibly damaging Het
Rabep1 A G 11: 70,808,267 (GRCm39) T408A probably damaging Het
Rims1 A T 1: 22,507,322 (GRCm39) D609E probably damaging Het
Sh2d4a A G 8: 68,781,907 (GRCm39) K172E probably benign Het
Slc12a9 A C 5: 137,323,808 (GRCm39) L369R probably damaging Het
Slc30a1 T C 1: 191,639,395 (GRCm39) C93R probably damaging Het
Tex35 C T 1: 156,927,742 (GRCm39) D143N probably damaging Het
Tgm3 A T 2: 129,880,400 (GRCm39) Y402F probably benign Het
Tmem17 T A 11: 22,468,490 (GRCm39) I143K possibly damaging Het
Tmprss11f A C 5: 86,692,682 (GRCm39) S81A probably benign Het
Trp53bp1 G A 2: 121,066,225 (GRCm39) P834S possibly damaging Het
Trpm4 C A 7: 44,968,683 (GRCm39) G417W probably damaging Het
Trpm6 A T 19: 18,831,654 (GRCm39) R1506S probably benign Het
Tspan18 A G 2: 93,040,305 (GRCm39) V150A possibly damaging Het
Ttc39d T C 17: 80,523,352 (GRCm39) F4L probably benign Het
Zdhhc4 A T 5: 143,307,619 (GRCm39) L134H probably damaging Het
Zfp407 A T 18: 84,577,416 (GRCm39) S1232R probably benign Het
Zswim2 A C 2: 83,747,227 (GRCm39) F353V probably benign Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCACAAGGCTGCTGATTAAG -3'
(R):5'- ATTCATCTTGAGATTGCCTGCC -3'

Sequencing Primer
(F):5'- AGGAATCTCTCTGTTTCAGAAGCTC -3'
(R):5'- TTGAGATTGCCTGCCAGCAC -3'
Posted On 2020-09-15