Incidental Mutation 'R7955:Tgm3'
ID649756
Institutional Source Beutler Lab
Gene Symbol Tgm3
Ensembl Gene ENSMUSG00000027401
Gene Nametransglutaminase 3, E polypeptide
SynonymsTG E
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7955 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location130012349-130050399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130038480 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 402 (Y402F)
Ref Sequence ENSEMBL: ENSMUSP00000105928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110299]
Predicted Effect probably benign
Transcript: ENSMUST00000110299
AA Change: Y402F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: Y402F

DomainStartEndE-ValueType
Pfam:Transglut_N 5 118 8.3e-33 PFAM
TGc 265 357 6.4e-39 SMART
Pfam:Transglut_C 483 588 3.9e-26 PFAM
Pfam:Transglut_C 595 693 4.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 T A 17: 33,545,639 V711D probably damaging Het
Adgrg5 G A 8: 94,937,697 V312M Het
Ankrd53 A G 6: 83,767,863 T352A probably benign Het
Ano4 T A 10: 88,995,226 M512L probably null Het
AW551984 A G 9: 39,596,664 F392S probably damaging Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Cldnd2 G T 7: 43,441,696 L17F possibly damaging Het
Clvs2 T C 10: 33,595,812 N166D possibly damaging Het
Cox10 A T 11: 63,993,924 N218K probably benign Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Daxx T A 17: 33,912,255 Y385* probably null Het
Dnmbp T C 19: 43,902,323 E335G probably benign Het
Erich3 C T 3: 154,739,314 Q376* probably null Het
Flot2 A G 11: 78,058,943 probably null Het
Ganc A G 2: 120,430,700 T289A probably damaging Het
Gm19668 G A 10: 77,798,796 T113I unknown Het
Gpm6a A G 8: 55,058,805 N238S probably damaging Het
Hps1 T C 19: 42,770,782 T124A probably damaging Het
Larp4b T C 13: 9,136,780 V48A probably benign Het
Magi2 A G 5: 20,389,072 H205R probably damaging Het
Map2 T A 1: 66,413,716 S588R probably damaging Het
Mocos A G 18: 24,666,159 D150G probably damaging Het
Msl2 A G 9: 101,102,155 D576G possibly damaging Het
Mybpc3 A G 2: 91,126,056 probably null Het
Myo3b A T 2: 70,095,279 Y58F probably benign Het
Ndst3 T G 3: 123,606,937 K440T probably benign Het
Ndst4 T A 3: 125,438,182 Y133* probably null Het
Nrcam G A 12: 44,584,954 V1097M probably benign Het
Olfr1348 A G 7: 6,502,079 I49T possibly damaging Het
Rabep1 A G 11: 70,917,441 T408A probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sh2d4a A G 8: 68,329,255 K172E probably benign Het
Slc12a9 A C 5: 137,325,546 L369R probably damaging Het
Slc30a1 T C 1: 191,907,283 C93R probably damaging Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tmem17 T A 11: 22,518,490 I143K possibly damaging Het
Tmprss11f A C 5: 86,544,823 S81A probably benign Het
Trp53bp1 G A 2: 121,235,744 P834S possibly damaging Het
Trpm4 C A 7: 45,319,259 G417W probably damaging Het
Trpm6 A T 19: 18,854,290 R1506S probably benign Het
Tspan18 A G 2: 93,209,960 V150A possibly damaging Het
Ttc39d T C 17: 80,215,923 F4L probably benign Het
Zdhhc4 A T 5: 143,321,864 L134H probably damaging Het
Zfp407 A T 18: 84,559,291 S1232R probably benign Het
Zswim2 A C 2: 83,916,883 F353V probably benign Het
Other mutations in Tgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Tgm3 APN 2 130038413 missense probably damaging 1.00
IGL00924:Tgm3 APN 2 130038374 missense probably damaging 1.00
IGL01469:Tgm3 APN 2 130024494 missense probably damaging 1.00
IGL01722:Tgm3 APN 2 130044568 missense probably damaging 0.99
IGL01787:Tgm3 APN 2 130047740 missense possibly damaging 0.85
IGL02269:Tgm3 APN 2 130024518 missense probably benign 0.02
IGL02437:Tgm3 APN 2 130030041 splice site probably null
IGL02449:Tgm3 APN 2 130038609 critical splice donor site probably null
IGL02992:Tgm3 APN 2 130041979 missense probably damaging 1.00
tortellini UTSW 2 130024585 critical splice donor site probably benign
ANU74:Tgm3 UTSW 2 130048390 missense probably damaging 1.00
R0523:Tgm3 UTSW 2 130044662 critical splice donor site probably null
R0833:Tgm3 UTSW 2 130026682 splice site probably benign
R0834:Tgm3 UTSW 2 130026757 missense probably benign 0.00
R0836:Tgm3 UTSW 2 130026682 splice site probably benign
R0940:Tgm3 UTSW 2 130012406 missense probably benign 0.00
R1354:Tgm3 UTSW 2 130041898 missense probably benign
R1642:Tgm3 UTSW 2 130047782 missense probably damaging 1.00
R1670:Tgm3 UTSW 2 130041768 nonsense probably null
R1715:Tgm3 UTSW 2 130026814 critical splice donor site probably null
R1944:Tgm3 UTSW 2 130029969 missense probably damaging 0.99
R2104:Tgm3 UTSW 2 130037483 missense probably benign 0.39
R3416:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R3417:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R4231:Tgm3 UTSW 2 130044589 nonsense probably null
R4296:Tgm3 UTSW 2 130038413 missense possibly damaging 0.77
R4794:Tgm3 UTSW 2 130041955 missense probably benign 0.00
R4948:Tgm3 UTSW 2 130048320 missense probably benign 0.00
R5034:Tgm3 UTSW 2 130037484 missense possibly damaging 0.95
R5144:Tgm3 UTSW 2 130048282 missense possibly damaging 0.95
R5786:Tgm3 UTSW 2 130026784 nonsense probably null
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6182:Tgm3 UTSW 2 130025301 nonsense probably null
R6219:Tgm3 UTSW 2 130038610 critical splice donor site probably null
R6901:Tgm3 UTSW 2 130041970 missense possibly damaging 0.95
R6969:Tgm3 UTSW 2 130042029 missense probably benign 0.06
R6980:Tgm3 UTSW 2 130026777 missense probably benign 0.17
R7282:Tgm3 UTSW 2 130024561 missense probably benign 0.00
R7317:Tgm3 UTSW 2 130048291 missense probably benign 0.09
R7513:Tgm3 UTSW 2 130024404 missense probably benign 0.00
R7517:Tgm3 UTSW 2 130041764 missense probably benign 0.01
R7793:Tgm3 UTSW 2 130012410 critical splice donor site probably null
R7822:Tgm3 UTSW 2 130041899 missense probably benign 0.00
X0065:Tgm3 UTSW 2 130024510 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGAGTCAGATCCTAGCCAGG -3'
(R):5'- TAGCTGGGATGTCGGAGTAC -3'

Sequencing Primer
(F):5'- AGATCCTAGCCAGGCTGGAG -3'
(R):5'- ACCGGGGAAAGGCTCTTTTTC -3'
Posted On2020-09-15