Incidental Mutation 'R7955:Clvs2'
ID649774
Institutional Source Beutler Lab
Gene Symbol Clvs2
Ensembl Gene ENSMUSG00000019785
Gene Nameclavesin 2
SynonymsRlbp1l2, A330019N05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7955 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location33512286-33624769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33595812 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 166 (N166D)
Ref Sequence ENSEMBL: ENSMUSP00000019920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019920] [ENSMUST00000160299] [ENSMUST00000161692]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019920
AA Change: N166D

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019920
Gene: ENSMUSG00000019785
AA Change: N166D

DomainStartEndE-ValueType
CRAL_TRIO_N 50 75 9.15e-5 SMART
SEC14 96 254 1.02e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160299
AA Change: N166D

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125100
Gene: ENSMUSG00000019785
AA Change: N166D

DomainStartEndE-ValueType
CRAL_TRIO_N 50 75 9.15e-5 SMART
Pfam:CRAL_TRIO 98 219 8e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161692
AA Change: N166D

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the SEC14/CRAL-TRIO family of proteins. A similar protein in rat is thought to function in the endosomal pathway between early endosomes and mature lysosomes. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 T A 17: 33,545,639 V711D probably damaging Het
Adgrg5 G A 8: 94,937,697 V312M Het
Ankrd53 A G 6: 83,767,863 T352A probably benign Het
Ano4 T A 10: 88,995,226 M512L probably null Het
AW551984 A G 9: 39,596,664 F392S probably damaging Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Cldnd2 G T 7: 43,441,696 L17F possibly damaging Het
Cox10 A T 11: 63,993,924 N218K probably benign Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Daxx T A 17: 33,912,255 Y385* probably null Het
Dnmbp T C 19: 43,902,323 E335G probably benign Het
Erich3 C T 3: 154,739,314 Q376* probably null Het
Flot2 A G 11: 78,058,943 probably null Het
Ganc A G 2: 120,430,700 T289A probably damaging Het
Gm19668 G A 10: 77,798,796 T113I unknown Het
Gpm6a A G 8: 55,058,805 N238S probably damaging Het
Hps1 T C 19: 42,770,782 T124A probably damaging Het
Larp4b T C 13: 9,136,780 V48A probably benign Het
Magi2 A G 5: 20,389,072 H205R probably damaging Het
Map2 T A 1: 66,413,716 S588R probably damaging Het
Mocos A G 18: 24,666,159 D150G probably damaging Het
Msl2 A G 9: 101,102,155 D576G possibly damaging Het
Mybpc3 A G 2: 91,126,056 probably null Het
Myo3b A T 2: 70,095,279 Y58F probably benign Het
Ndst3 T G 3: 123,606,937 K440T probably benign Het
Ndst4 T A 3: 125,438,182 Y133* probably null Het
Nrcam G A 12: 44,584,954 V1097M probably benign Het
Olfr1348 A G 7: 6,502,079 I49T possibly damaging Het
Rabep1 A G 11: 70,917,441 T408A probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sh2d4a A G 8: 68,329,255 K172E probably benign Het
Slc12a9 A C 5: 137,325,546 L369R probably damaging Het
Slc30a1 T C 1: 191,907,283 C93R probably damaging Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tgm3 A T 2: 130,038,480 Y402F probably benign Het
Tmem17 T A 11: 22,518,490 I143K possibly damaging Het
Tmprss11f A C 5: 86,544,823 S81A probably benign Het
Trp53bp1 G A 2: 121,235,744 P834S possibly damaging Het
Trpm4 C A 7: 45,319,259 G417W probably damaging Het
Trpm6 A T 19: 18,854,290 R1506S probably benign Het
Tspan18 A G 2: 93,209,960 V150A possibly damaging Het
Ttc39d T C 17: 80,215,923 F4L probably benign Het
Zdhhc4 A T 5: 143,321,864 L134H probably damaging Het
Zfp407 A T 18: 84,559,291 S1232R probably benign Het
Zswim2 A C 2: 83,916,883 F353V probably benign Het
Other mutations in Clvs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Clvs2 APN 10 33528463 missense probably benign 0.03
IGL02304:Clvs2 APN 10 33528447 missense probably benign 0.02
IGL02967:Clvs2 APN 10 33595788 missense probably damaging 0.98
R0085:Clvs2 UTSW 10 33622546 missense possibly damaging 0.70
R0346:Clvs2 UTSW 10 33622546 missense possibly damaging 0.70
R1228:Clvs2 UTSW 10 33622604 missense probably benign 0.05
R1405:Clvs2 UTSW 10 33513260 makesense probably null
R1405:Clvs2 UTSW 10 33513260 makesense probably null
R2176:Clvs2 UTSW 10 33595815 missense probably damaging 1.00
R2280:Clvs2 UTSW 10 33528500 missense probably damaging 1.00
R3413:Clvs2 UTSW 10 33622971 start gained probably benign
R4008:Clvs2 UTSW 10 33543462 missense probably damaging 1.00
R4855:Clvs2 UTSW 10 33622646 missense probably damaging 1.00
R5814:Clvs2 UTSW 10 33528507 missense probably benign 0.01
R6265:Clvs2 UTSW 10 33528515 missense possibly damaging 0.93
R6730:Clvs2 UTSW 10 33528521 missense probably damaging 1.00
R7558:Clvs2 UTSW 10 33543464 missense probably damaging 1.00
R8337:Clvs2 UTSW 10 33528488 missense possibly damaging 0.95
R8423:Clvs2 UTSW 10 33622859 missense possibly damaging 0.58
RF003:Clvs2 UTSW 10 33622925 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAAGACCCACATCCTGCTTTC -3'
(R):5'- TCATGGTCCATTTAAGTCAATCTCT -3'

Sequencing Primer
(F):5'- GACCCACATCCTGCTTTCTCTTTG -3'
(R):5'- TCATTCCCTAAACAAATCTCAAGGTC -3'
Posted On2020-09-15