Incidental Mutation 'R7955:Mocos'
ID649787
Institutional Source Beutler Lab
Gene Symbol Mocos
Ensembl Gene ENSMUSG00000039616
Gene Namemolybdenum cofactor sulfurase
Synonyms1110018O12Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_026779.1; MGI:1915841

Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R7955 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location24653691-24701556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24666159 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 150 (D150G)
Ref Sequence ENSEMBL: ENSMUSP00000063609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068006]
Predicted Effect probably damaging
Transcript: ENSMUST00000068006
AA Change: D150G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063609
Gene: ENSMUSG00000039616
AA Change: D150G

DomainStartEndE-ValueType
Pfam:Aminotran_5 50 481 7.5e-29 PFAM
Pfam:MOSC_N 569 689 1.1e-32 PFAM
Pfam:MOSC 715 853 3.7e-21 PFAM
Meta Mutation Damage Score 0.7926 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MOCOS sulfurates the molybdenum cofactor of xanthine dehydrogenase (XDH; MIM 607633) and aldehyde oxidase (AOX1; MIM 602841), which is required for their enzymatic activities (Ichida et al., 2001 [PubMed 11302742]).[supplied by OMIM, Feb 2010]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 T A 17: 33,545,639 V711D probably damaging Het
Adgrg5 G A 8: 94,937,697 V312M Het
Ankrd53 A G 6: 83,767,863 T352A probably benign Het
Ano4 T A 10: 88,995,226 M512L probably null Het
AW551984 A G 9: 39,596,664 F392S probably damaging Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Cldnd2 G T 7: 43,441,696 L17F possibly damaging Het
Clvs2 T C 10: 33,595,812 N166D possibly damaging Het
Cox10 A T 11: 63,993,924 N218K probably benign Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Daxx T A 17: 33,912,255 Y385* probably null Het
Dnmbp T C 19: 43,902,323 E335G probably benign Het
Erich3 C T 3: 154,739,314 Q376* probably null Het
Flot2 A G 11: 78,058,943 probably null Het
Ganc A G 2: 120,430,700 T289A probably damaging Het
Gm19668 G A 10: 77,798,796 T113I unknown Het
Gpm6a A G 8: 55,058,805 N238S probably damaging Het
Hps1 T C 19: 42,770,782 T124A probably damaging Het
Larp4b T C 13: 9,136,780 V48A probably benign Het
Magi2 A G 5: 20,389,072 H205R probably damaging Het
Map2 T A 1: 66,413,716 S588R probably damaging Het
Msl2 A G 9: 101,102,155 D576G possibly damaging Het
Mybpc3 A G 2: 91,126,056 probably null Het
Myo3b A T 2: 70,095,279 Y58F probably benign Het
Ndst3 T G 3: 123,606,937 K440T probably benign Het
Ndst4 T A 3: 125,438,182 Y133* probably null Het
Nrcam G A 12: 44,584,954 V1097M probably benign Het
Olfr1348 A G 7: 6,502,079 I49T possibly damaging Het
Rabep1 A G 11: 70,917,441 T408A probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sh2d4a A G 8: 68,329,255 K172E probably benign Het
Slc12a9 A C 5: 137,325,546 L369R probably damaging Het
Slc30a1 T C 1: 191,907,283 C93R probably damaging Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tgm3 A T 2: 130,038,480 Y402F probably benign Het
Tmem17 T A 11: 22,518,490 I143K possibly damaging Het
Tmprss11f A C 5: 86,544,823 S81A probably benign Het
Trp53bp1 G A 2: 121,235,744 P834S possibly damaging Het
Trpm4 C A 7: 45,319,259 G417W probably damaging Het
Trpm6 A T 19: 18,854,290 R1506S probably benign Het
Tspan18 A G 2: 93,209,960 V150A possibly damaging Het
Ttc39d T C 17: 80,215,923 F4L probably benign Het
Zdhhc4 A T 5: 143,321,864 L134H probably damaging Het
Zfp407 A T 18: 84,559,291 S1232R probably benign Het
Zswim2 A C 2: 83,916,883 F353V probably benign Het
Other mutations in Mocos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Mocos APN 18 24660044 missense possibly damaging 0.88
IGL01859:Mocos APN 18 24666660 splice site probably benign
IGL01884:Mocos APN 18 24683216 missense probably damaging 1.00
IGL02174:Mocos APN 18 24695896 missense probably benign 0.00
IGL02966:Mocos APN 18 24676611 missense probably damaging 1.00
IGL02976:Mocos APN 18 24666569 missense possibly damaging 0.92
buteo UTSW 18 24666410 missense probably damaging 0.98
P0008:Mocos UTSW 18 24679606 missense probably benign 0.32
PIT4810001:Mocos UTSW 18 24686702 missense probably damaging 1.00
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0132:Mocos UTSW 18 24679762 missense probably benign 0.01
R0265:Mocos UTSW 18 24666276 missense probably benign 0.01
R0737:Mocos UTSW 18 24688987 missense probably damaging 0.98
R1231:Mocos UTSW 18 24679701 missense probably benign 0.01
R1351:Mocos UTSW 18 24660050 missense probably damaging 1.00
R1699:Mocos UTSW 18 24683216 missense probably damaging 1.00
R1853:Mocos UTSW 18 24695969 missense probably damaging 1.00
R2190:Mocos UTSW 18 24664057 missense probably benign 0.01
R2350:Mocos UTSW 18 24666656 splice site probably benign
R2680:Mocos UTSW 18 24676629 missense probably damaging 1.00
R3840:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3841:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3847:Mocos UTSW 18 24676662 missense probably damaging 0.99
R4059:Mocos UTSW 18 24679390 missense probably damaging 1.00
R4158:Mocos UTSW 18 24674246 missense probably damaging 0.99
R4205:Mocos UTSW 18 24666191 missense possibly damaging 0.88
R4514:Mocos UTSW 18 24683212 missense probably damaging 0.99
R4589:Mocos UTSW 18 24654038 missense probably damaging 0.99
R4667:Mocos UTSW 18 24666434 missense probably benign 0.11
R4668:Mocos UTSW 18 24666434 missense probably benign 0.11
R5162:Mocos UTSW 18 24654052 missense probably damaging 0.98
R5187:Mocos UTSW 18 24692554 missense probably damaging 0.97
R5533:Mocos UTSW 18 24674300 missense probably damaging 1.00
R5629:Mocos UTSW 18 24664085 critical splice donor site probably null
R5661:Mocos UTSW 18 24665995 splice site probably null
R5952:Mocos UTSW 18 24701387 missense possibly damaging 0.91
R5987:Mocos UTSW 18 24686693 missense probably damaging 1.00
R6173:Mocos UTSW 18 24676582 missense probably benign 0.03
R6209:Mocos UTSW 18 24666615 missense probably benign 0.41
R6376:Mocos UTSW 18 24701485 missense possibly damaging 0.50
R6416:Mocos UTSW 18 24701456 missense probably damaging 0.99
R6452:Mocos UTSW 18 24695941 missense probably benign 0.02
R6520:Mocos UTSW 18 24666390 missense probably benign 0.01
R6631:Mocos UTSW 18 24699931 missense probably benign 0.03
R6669:Mocos UTSW 18 24666410 missense probably damaging 0.98
R7114:Mocos UTSW 18 24666515 missense probably damaging 1.00
R7366:Mocos UTSW 18 24676616 missense probably damaging 1.00
R7690:Mocos UTSW 18 24664025 missense probably damaging 1.00
R8458:Mocos UTSW 18 24666257 missense probably benign 0.00
R8762:Mocos UTSW 18 24679497 missense probably damaging 0.99
Z1176:Mocos UTSW 18 24670633 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATGCCCTCCTGTGTAAAAC -3'
(R):5'- CCCGAAAAGTTACTCTGAGCTG -3'

Sequencing Primer
(F):5'- GCCCTCCTGTGTAAAACAAATTGG -3'
(R):5'- AAGTTACTCTGAGCTGGGTAAC -3'
Posted On2020-09-15