Incidental Mutation 'R7956:Gne'
ID649804
Institutional Source Beutler Lab
Gene Symbol Gne
Ensembl Gene ENSMUSG00000028479
Gene Nameglucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7956 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location44034075-44084177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44044962 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 391 (I391L)
Ref Sequence ENSEMBL: ENSMUSP00000030201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030201] [ENSMUST00000102936] [ENSMUST00000133709] [ENSMUST00000172533] [ENSMUST00000173234]
Predicted Effect probably benign
Transcript: ENSMUST00000030201
AA Change: I391L

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030201
Gene: ENSMUSG00000028479
AA Change: I391L

DomainStartEndE-ValueType
Pfam:Epimerase_2 63 406 2.3e-69 PFAM
Pfam:ROK 440 747 1.4e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102936
AA Change: I360L

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100000
Gene: ENSMUSG00000028479
AA Change: I360L

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 5.1e-75 PFAM
Pfam:ROK 411 596 6.5e-44 PFAM
low complexity region 685 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133709
Predicted Effect probably benign
Transcript: ENSMUST00000172533
AA Change: I360L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134040
Gene: ENSMUSG00000028479
AA Change: I360L

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 1.6e-75 PFAM
PDB:3EO3|C 406 471 2e-33 PDB
SCOP:d1bu6o1 410 462 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173234
AA Change: I360L

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133521
Gene: ENSMUSG00000028479
AA Change: I360L

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 3.9e-75 PFAM
Pfam:ROK 453 522 1.6e-16 PFAM
low complexity region 611 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174522
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes a block in sialic acid biosynthesis and early embryonic lethality. A knockout mouse expressing the human V572L mutation shows features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,950,762 S332G possibly damaging Het
Acaca A T 11: 84,320,580 N1573Y probably damaging Het
Arhgef33 A G 17: 80,355,048 K220R possibly damaging Het
Arsj A T 3: 126,438,502 D299V probably damaging Het
Asic3 A C 5: 24,416,977 I412L possibly damaging Het
AU018091 A T 7: 3,161,255 L278Q probably benign Het
Baat A T 4: 49,490,117 F322L probably damaging Het
Bap1 A G 14: 31,255,568 Q280R probably benign Het
Bet1 T C 6: 4,079,965 E66G probably benign Het
Brpf1 T C 6: 113,320,532 S1000P probably benign Het
Ccdc78 A T 17: 25,787,117 E86D possibly damaging Het
Ccdc88a T G 11: 29,463,892 L810R probably damaging Het
Cd209f T C 8: 4,104,859 T80A probably benign Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Cldn15 T C 5: 136,974,650 S169P probably damaging Het
Corin A G 5: 72,422,187 S281P probably damaging Het
Coro1a A G 7: 126,701,555 V200A probably benign Het
Crebrf C G 17: 26,742,657 P243A probably benign Het
Cxxc1 T G 18: 74,218,983 probably null Het
D10Jhu81e T C 10: 78,163,571 probably null Het
Dera C T 6: 137,836,828 T282M probably benign Het
Dnah12 A T 14: 26,709,272 D345V probably damaging Het
Dopey2 T C 16: 93,771,028 probably null Het
Dscr3 T C 16: 94,501,646 N234D probably damaging Het
Dst T A 1: 34,225,618 V2623E probably damaging Het
Dysf T C 6: 84,008,996 F28L probably benign Het
Eogt C A 6: 97,143,965 V96F probably benign Het
Exoc1 A T 5: 76,557,857 T464S probably benign Het
Fam234a A G 17: 26,216,577 Y278H probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr1 T C 1: 63,183,506 N190S probably damaging Het
Gpr22 G T 12: 31,709,220 T301K possibly damaging Het
Gria1 A G 11: 57,189,800 D203G possibly damaging Het
Grin2c T C 11: 115,250,148 E1048G probably benign Het
Hcn4 A G 9: 58,844,173 T361A unknown Het
Herc2 T C 7: 56,113,400 S918P probably damaging Het
Hr A G 14: 70,559,887 E520G probably benign Het
Idi1 T G 13: 8,887,960 S147R possibly damaging Het
Irf9 G A 14: 55,609,024 G464E probably benign Het
Kif16b T C 2: 142,862,470 Y63C probably benign Het
Klhl31 A T 9: 77,650,621 E206D probably benign Het
Lrch3 A G 16: 32,986,007 M454V probably null Het
Lrp1b A C 2: 41,282,149 probably null Het
Lyst A G 13: 13,641,203 D1224G possibly damaging Het
Maf1 T A 15: 76,352,496 F9L probably benign Het
Mllt10 T A 2: 18,170,257 I542N probably benign Het
Mrpl19 T C 6: 81,963,981 N143S probably benign Het
Myo5c A G 9: 75,252,563 N291S probably benign Het
Myocd G T 11: 65,269,668 L11M possibly damaging Het
Olfr1436 A C 19: 12,298,302 F277V probably damaging Het
Olfr202 C A 16: 59,284,493 M1I probably null Het
Olfr706 G A 7: 106,885,971 T282I possibly damaging Het
Otogl T C 10: 107,878,026 I511V possibly damaging Het
Phf19 T C 2: 34,906,555 Y121C possibly damaging Het
Pik3c2a T C 7: 116,350,115 T1346A probably benign Het
Polr2b A G 5: 77,320,245 T131A probably benign Het
Pom121 T C 5: 135,383,961 T456A unknown Het
Pom121l2 T C 13: 21,983,146 L529S probably damaging Het
Prss34 A G 17: 25,299,579 I214V probably benign Het
Prss42 A G 9: 110,799,334 Y182C probably damaging Het
Rapgef1 A G 2: 29,699,015 I223V probably benign Het
Rbbp6 C T 7: 123,001,338 P1523S unknown Het
Ripk1 T G 13: 34,009,683 N9K probably benign Het
Six4 A G 12: 73,103,761 L670S possibly damaging Het
Skint6 C T 4: 112,846,697 D994N possibly damaging Het
Slc18a1 T C 8: 69,038,814 D516G probably benign Het
Slc35g3 A T 11: 69,760,797 Y121N probably damaging Het
Slc41a1 T G 1: 131,844,028 S393R possibly damaging Het
Smg7 T C 1: 152,844,202 H818R probably benign Het
Sorl1 A G 9: 41,989,359 Y1686H probably damaging Het
Stab1 G T 14: 31,160,024 T521K probably benign Het
Stard9 T A 2: 120,705,371 Y4036* probably null Het
Tek T G 4: 94,799,343 probably null Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tgm1 T A 14: 55,708,895 H428L probably benign Het
Tigd3 G A 19: 5,892,566 P179S possibly damaging Het
Tnip3 T A 6: 65,614,795 probably null Het
Ttc1 A G 11: 43,736,413 probably null Het
Utp20 C T 10: 88,782,614 E1175K probably benign Het
Vmn1r151 A T 7: 22,499,660 S7T possibly damaging Het
Vmn1r34 T A 6: 66,637,793 probably benign Het
Vmn2r74 A T 7: 85,955,958 M494K probably benign Het
Vsig10l T C 7: 43,468,070 S594P probably benign Het
Zfp937 A G 2: 150,239,156 S369G probably benign Het
Other mutations in Gne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Gne APN 4 44041860 splice site probably null
IGL02028:Gne APN 4 44066852 missense probably damaging 1.00
IGL02106:Gne APN 4 44037306 missense probably damaging 1.00
IGL02216:Gne APN 4 44044761 missense probably benign 0.43
IGL03095:Gne APN 4 44055211 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0310:Gne UTSW 4 44060157 nonsense probably null
R0606:Gne UTSW 4 44042244 missense possibly damaging 0.55
R0658:Gne UTSW 4 44039033 missense possibly damaging 0.85
R1878:Gne UTSW 4 44040434 missense probably damaging 1.00
R2009:Gne UTSW 4 44055273 missense probably benign 0.00
R2338:Gne UTSW 4 44042196 missense probably damaging 0.99
R4043:Gne UTSW 4 44040383 missense possibly damaging 0.65
R4361:Gne UTSW 4 44059947 missense possibly damaging 0.63
R4725:Gne UTSW 4 44066806 missense probably benign 0.31
R4869:Gne UTSW 4 44055204 critical splice donor site probably null
R5511:Gne UTSW 4 44041843 missense probably damaging 0.99
R5797:Gne UTSW 4 44060030 missense probably damaging 1.00
R6016:Gne UTSW 4 44039063 missense probably damaging 0.99
R6176:Gne UTSW 4 44053019 intron probably benign
R6461:Gne UTSW 4 44060078 missense probably damaging 1.00
R6804:Gne UTSW 4 44060210 missense probably damaging 1.00
R7170:Gne UTSW 4 44040361 missense possibly damaging 0.95
R7191:Gne UTSW 4 44040266 missense probably benign 0.16
R7264:Gne UTSW 4 44042175 missense probably damaging 0.96
R7413:Gne UTSW 4 44044857 missense probably benign 0.06
R8184:Gne UTSW 4 44084061 missense probably benign 0.07
R8734:Gne UTSW 4 44072911 unclassified probably benign
RF012:Gne UTSW 4 44060045 missense probably damaging 1.00
RF014:Gne UTSW 4 44060045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCCCGCCAAGATCAACAG -3'
(R):5'- TCAAAGGCCCAGCTGTTTC -3'

Sequencing Primer
(F):5'- GCCAAGGCACTCAGAGTTTC -3'
(R):5'- CTATGTAAGAAGCTAGGCTGGCCTC -3'
Posted On2020-09-15