Incidental Mutation 'R7956:Skint6'
ID 649806
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission 046000-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7956 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 112703894 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 994 (D994N)
Ref Sequence ENSEMBL: ENSMUSP00000121870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000138966
AA Change: D994N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: D994N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171224
AA Change: D994N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: D994N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,834,963 (GRCm39) S332G possibly damaging Het
Acaca A T 11: 84,211,406 (GRCm39) N1573Y probably damaging Het
Arhgef33 A G 17: 80,662,477 (GRCm39) K220R possibly damaging Het
Arsj A T 3: 126,232,151 (GRCm39) D299V probably damaging Het
Asic3 A C 5: 24,621,975 (GRCm39) I412L possibly damaging Het
AU018091 A T 7: 3,211,095 (GRCm39) L278Q probably benign Het
Baat A T 4: 49,490,117 (GRCm39) F322L probably damaging Het
Bap1 A G 14: 30,977,525 (GRCm39) Q280R probably benign Het
Bet1 T C 6: 4,079,965 (GRCm39) E66G probably benign Het
Brpf1 T C 6: 113,297,493 (GRCm39) S1000P probably benign Het
Ccdc78 A T 17: 26,006,091 (GRCm39) E86D possibly damaging Het
Ccdc88a T G 11: 29,413,892 (GRCm39) L810R probably damaging Het
Cd209f T C 8: 4,154,859 (GRCm39) T80A probably benign Het
Chrna7 T G 7: 62,753,541 (GRCm39) K326T possibly damaging Het
Cldn15 T C 5: 137,003,504 (GRCm39) S169P probably damaging Het
Cmklr2 T C 1: 63,222,665 (GRCm39) N190S probably damaging Het
Corin A G 5: 72,579,530 (GRCm39) S281P probably damaging Het
Coro1a A G 7: 126,300,727 (GRCm39) V200A probably benign Het
Crebrf C G 17: 26,961,631 (GRCm39) P243A probably benign Het
Cxxc1 T G 18: 74,352,054 (GRCm39) probably null Het
Dera C T 6: 137,813,826 (GRCm39) T282M probably benign Het
Dnah12 A T 14: 26,430,427 (GRCm39) D345V probably damaging Het
Dop1b T C 16: 93,567,916 (GRCm39) probably null Het
Dst T A 1: 34,264,699 (GRCm39) V2623E probably damaging Het
Dysf T C 6: 83,985,978 (GRCm39) F28L probably benign Het
Eogt C A 6: 97,120,926 (GRCm39) V96F probably benign Het
Exoc1 A T 5: 76,705,704 (GRCm39) T464S probably benign Het
Fam234a A G 17: 26,435,551 (GRCm39) Y278H probably damaging Het
Gatd3a T C 10: 77,999,405 (GRCm39) probably null Het
Gne T A 4: 44,044,962 (GRCm39) I391L probably benign Het
Gpr22 G T 12: 31,759,219 (GRCm39) T301K possibly damaging Het
Gria1 A G 11: 57,080,626 (GRCm39) D203G possibly damaging Het
Grin2c T C 11: 115,140,974 (GRCm39) E1048G probably benign Het
Hcn4 A G 9: 58,751,456 (GRCm39) T361A unknown Het
Herc2 T C 7: 55,763,148 (GRCm39) S918P probably damaging Het
Hr A G 14: 70,797,327 (GRCm39) E520G probably benign Het
Idi1 T G 13: 8,937,996 (GRCm39) S147R possibly damaging Het
Irf9 G A 14: 55,846,481 (GRCm39) G464E probably benign Het
Kif16b T C 2: 142,704,390 (GRCm39) Y63C probably benign Het
Klhl31 A T 9: 77,557,903 (GRCm39) E206D probably benign Het
Lrch3 A G 16: 32,806,377 (GRCm39) M454V probably null Het
Lrp1b A C 2: 41,172,161 (GRCm39) probably null Het
Lyst A G 13: 13,815,788 (GRCm39) D1224G possibly damaging Het
Maf1 T A 15: 76,236,696 (GRCm39) F9L probably benign Het
Mllt10 T A 2: 18,175,068 (GRCm39) I542N probably benign Het
Mrpl19 T C 6: 81,940,962 (GRCm39) N143S probably benign Het
Myo5c A G 9: 75,159,845 (GRCm39) N291S probably benign Het
Myocd G T 11: 65,160,494 (GRCm39) L11M possibly damaging Het
Or2ag2 G A 7: 106,485,178 (GRCm39) T282I possibly damaging Het
Or5ac20 C A 16: 59,104,856 (GRCm39) M1I probably null Het
Or5an10 A C 19: 12,275,666 (GRCm39) F277V probably damaging Het
Otogl T C 10: 107,713,887 (GRCm39) I511V possibly damaging Het
Phf19 T C 2: 34,796,567 (GRCm39) Y121C possibly damaging Het
Pik3c2a T C 7: 115,949,350 (GRCm39) T1346A probably benign Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Polr2b A G 5: 77,468,092 (GRCm39) T131A probably benign Het
Pom121 T C 5: 135,412,815 (GRCm39) T456A unknown Het
Pom121l2 T C 13: 22,167,316 (GRCm39) L529S probably damaging Het
Prss34 A G 17: 25,518,553 (GRCm39) I214V probably benign Het
Prss42 A G 9: 110,628,402 (GRCm39) Y182C probably damaging Het
Rapgef1 A G 2: 29,589,027 (GRCm39) I223V probably benign Het
Rbbp6 C T 7: 122,600,561 (GRCm39) P1523S unknown Het
Ripk1 T G 13: 34,193,666 (GRCm39) N9K probably benign Het
Six4 A G 12: 73,150,535 (GRCm39) L670S possibly damaging Het
Slc18a1 T C 8: 69,491,466 (GRCm39) D516G probably benign Het
Slc35g3 A T 11: 69,651,623 (GRCm39) Y121N probably damaging Het
Slc41a1 T G 1: 131,771,766 (GRCm39) S393R possibly damaging Het
Smg7 T C 1: 152,719,953 (GRCm39) H818R probably benign Het
Sorl1 A G 9: 41,900,655 (GRCm39) Y1686H probably damaging Het
Stab1 G T 14: 30,881,981 (GRCm39) T521K probably benign Het
Stard9 T A 2: 120,535,852 (GRCm39) Y4036* probably null Het
Tek T G 4: 94,687,580 (GRCm39) probably null Het
Tex35 C T 1: 156,927,742 (GRCm39) D143N probably damaging Het
Tgm1 T A 14: 55,946,352 (GRCm39) H428L probably benign Het
Tigd3 G A 19: 5,942,594 (GRCm39) P179S possibly damaging Het
Tnip3 T A 6: 65,591,779 (GRCm39) probably null Het
Ttc1 A G 11: 43,627,240 (GRCm39) probably null Het
Utp20 C T 10: 88,618,476 (GRCm39) E1175K probably benign Het
Vmn1r151 A T 7: 22,199,085 (GRCm39) S7T possibly damaging Het
Vmn1r34 T A 6: 66,614,777 (GRCm39) probably benign Het
Vmn2r74 A T 7: 85,605,166 (GRCm39) M494K probably benign Het
Vps26c T C 16: 94,302,505 (GRCm39) N234D probably damaging Het
Vsig10l T C 7: 43,117,494 (GRCm39) S594P probably benign Het
Zfp937 A G 2: 150,081,076 (GRCm39) S369G probably benign Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4900:Skint6 UTSW 4 112,924,667 (GRCm39) missense probably benign 0.03
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5447:Skint6 UTSW 4 112,963,106 (GRCm39) missense probably benign 0.34
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5629:Skint6 UTSW 4 112,870,176 (GRCm39) missense possibly damaging 0.86
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7269:Skint6 UTSW 4 112,711,686 (GRCm39) splice site probably null
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7438:Skint6 UTSW 4 113,095,425 (GRCm39) missense probably damaging 1.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8344:Skint6 UTSW 4 113,093,642 (GRCm39) missense probably damaging 1.00
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113,049,869 (GRCm39) missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112,846,149 (GRCm39) missense probably benign 0.00
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8949:Skint6 UTSW 4 112,931,296 (GRCm39) missense probably benign 0.04
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9515:Skint6 UTSW 4 112,715,375 (GRCm39) missense probably benign
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9689:Skint6 UTSW 4 113,093,546 (GRCm39) missense probably damaging 0.99
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAAGATCCAATTTTCACCATGTGTCCT -3'
(R):5'- ATAGATCCAAGAGAGGTACAGCA -3'

Sequencing Primer
(F):5'- CTCCTGGATTAGTTTTTCCTGAGAGC -3'
(R):5'- AGGTACAGCAGGACATTTCC -3'
Posted On 2020-09-15